Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: p34
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7125; Vector Backbone:p2Bac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_39221 Copy
Genetic Insert: p44
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7125; Vector Backbone:p2Bac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_39220 Copy
Species: Homo sapiens
Genetic Insert: ERK2-MEK1 Fusion
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9799732
Comments: rat ERK2 fused to human MEK1 with a linker in between
Proper citation: RRID:Addgene_39194 Copy
Genetic Insert: none
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pFB-CT10HF-LIC; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin
Comments: Primers for LIC cloning:
Add the following 5’ extensions to the PCR primers:
Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon)
Downstream: GATTGGAAGTAGAGGTTCTCTGC
The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector.
Proper citation: RRID:Addgene_39191 Copy
Species: Homo sapiens
Genetic Insert: p52
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7125; Vector Backbone:p2Bac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_39219 Copy
Species: Homo sapiens
Genetic Insert: XPG
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6646; Vector Backbone:pMAL-c2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7657672
Proper citation: RRID:Addgene_39215 Copy
Species: Homo sapiens
Genetic Insert: ABL2
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pFB-LIC-Bse; Vector Types:Baculovirus Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/3GVU/
Proper citation: RRID:Addgene_39178 Copy
Species: Homo sapiens
Genetic Insert: BBOX1
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pFB-LIC-Bse; Vector Types:Baculovirus Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/3MS5/
Proper citation: RRID:Addgene_39176 Copy
Species: Homo sapiens
Genetic Insert: ROR2
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pFBOH-MHL; Vector Types:Baculovirus Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/3ZZW/
Proper citation: RRID:Addgene_39183 Copy
Species: Homo sapiens
Genetic Insert: ACSM2B
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pFB-LIC-Bse; Vector Types:Baculovirus Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/3C5E/
Proper citation: RRID:Addgene_39167 Copy
Species: Homo sapiens
Genetic Insert: NEK2
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pET22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/2JAV/
Proper citation: RRID:Addgene_39163 Copy
Species: Homo sapiens
Genetic Insert: PTPN5
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/2BIJ/
Proper citation: RRID:Addgene_39166 Copy
Species: Homo sapiens
Genetic Insert: PTPRB
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/2AHS/
Proper citation: RRID:Addgene_39165 Copy
Species: Homo sapiens
Genetic Insert: TNIK
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pFB-LIC-Bse; Vector Types:Baculovirus Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/2X7F/
Proper citation: RRID:Addgene_39171 Copy
Species: Homo sapiens
Genetic Insert: MST4
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/3GGF/
Proper citation: RRID:Addgene_39172 Copy
Species: Homo sapiens
Genetic Insert: HSD17B4
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/1ZBQ/
Proper citation: RRID:Addgene_39156 Copy
Species: Homo sapiens
Genetic Insert: PECR
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/1YXM/
Proper citation: RRID:Addgene_39158 Copy
Species: Homo sapiens
Genetic Insert: HSD17B10
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/2O23/
Proper citation: RRID:Addgene_39153 Copy
Species: Homo sapiens
Genetic Insert: HSD11B1
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/2BEL/ Alt_Gene_1=HSD11B1: hydroxysteroid (11-beta) dehydrogenase 1 [RefSeq isoform 1; tv1] (aka HDL, 11-DH, HSD11, HSD11B, HSD11L, MGC13539, 11-beta-HSD1)
Proper citation: RRID:Addgene_39155 Copy
Species: Homo sapiens
Genetic Insert: HPGD
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/2GDZ/
Proper citation: RRID:Addgene_39154 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.