Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:mus musculus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

12,959 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pCMV-sport2-mGCN5 FU, FLAG Tagged
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_23098 mouse Gcn5 mRNA Mus musculus Ampicillin PMID:10675335 Backbone Marker:Invitrogen; Backbone Size:4473; Vector Backbone:pCMV-sport2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin missing 50 bp upstream of ATG start site. 2026-08-15 01:12:18 5
pCMV-Tag2B Flag BimEL(TD)
 
Resource Report
Resource Website 		RRID:Addgene_23092 Bim EL (TD) Mus musculus Kanamycin PMID:18498746 Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Changed Threonine 112 to Aspartate 2026-08-15 01:12:18 0
pCMV-Tag2B Flag BimEL(TA)
 
Resource Report
Resource Website 		RRID:Addgene_23093 Bim EL (TA) Mus musculus Kanamycin PMID:18498746 Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Changed Threonine 112 to Alanine 2026-08-15 01:12:17 0
pCMV-Tag2B Flag BimEL
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_23090 Bim EL Mus musculus Kanamycin PMID:18498746 Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:12:17 1
Sox17 Flox
 
Resource Report
Resource Website 		RRID:Addgene_23335 Sex determining region Y-box containing gene 17 Mus musculus Ampicillin PMID:17655922 The source of ploxPFLPneo is Hiraoka et al Mol Cell Biol 26, 6139. Backbone Size:3000; Vector Backbone:ploxPFLPneo; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin None 2026-08-15 01:12:19 0
pcDNA-Ikka-HA WT
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_23296 IKK alpha Mus musculus Ampicillin PMID:9710600 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:19 2
pcDNA-Ikka-HA (K44M)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_23297 IKK alpha Mus musculus Ampicillin PMID:9710600 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin K44M 2026-08-15 01:12:19 2
pCMV-Tag2B Flag BimS
 
Resource Report
Resource Website 		RRID:Addgene_23283 pCMV Tag2b Bim S Mus musculus Kanamycin PMID:18498746 Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:12:19 0
MIGR-RORgt
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24069 Rorgt Mus musculus Ampicillin Backbone Size:6000; Vector Backbone:pMIGR; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:28 9
MIGR-IL23R
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24066 IL23R Mus musculus Ampicillin IL23R cDNA amplified through IL6 treated cDNA as 2 parts (5' part ATG-134-BamHI; 3' part 134-STOP). 5' part cloned into pcDNA3 XhoI/BamHI 3' part cloned into MSCV hCD2 Part linked together in pcDNA3 (XhoI-MluI) Then cut with XhoI/NruI cloned into pMIGR (XhoI/HpaI) Backbone Size:6000; Vector Backbone:pMIGR; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:27 1
LMP 1066
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24071 Foxp3 Mus musculus Ampicillin PMID:18368049 The target sequence of Foxp3: 5′-GGCAGAGGACACTCAATGAAAT-3′ Backbone Marker:Open Biosystems; Backbone Size:7894; Vector Backbone:MSCV-LTRmiR30-PIG (LMP); Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:12:27 3
pCDNA3 Flag DLC2
 
Resource Report
Resource Website 		RRID:Addgene_24269 DLC2 Mus musculus Ampicillin PMID:12591950 Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:29 0
pGSTag DLC2
 
Resource Report
Resource Website 		RRID:Addgene_24270 DLC2 Mus musculus Ampicillin PMID:12591950 Backbone Size:5057; Vector Backbone:pGSTag; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:30 0
nAChR beta2 WT
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24272 nAChR beta2 WT Mus musculus Ampicillin PMID:14684858 Backbone Size:5472; Vector Backbone:pCIneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:29 2
pLLOXmPOLBeta
 
Resource Report
Resource Website 		RRID:Addgene_24174 pLLOXmPOLbeta Mus musculus Ampicillin PMID:20096707 shRNA oligo sequence is - 5'-TGATCAGTACTACTGTGGTGTTCAAGAGACACCACAGTAGTACTGATCTTTTTTC Backbone Marker:Obtained from MIT vector core; Backbone Size:70000; Vector Backbone:pLentiLox3.7; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin x 2026-08-15 01:12:29 0
pIRES.Puro.mBeta
 
Resource Report
Resource Website 		RRID:Addgene_24175 pIRES.Puro.mBeta Mus musculus Ampicillin PMID:20096707 Mouse pol beta cDNA was cloned into pENTR-D (invitrogen). The mouse pol beta open reading frame was transferred from pENTRD-mPOL beta to a gateway modified pIRES-Puro plasmid via LR recombination reaction. Backbone Marker:Clontech (Unmodified); Backbone Size:6000; Vector Backbone:pIRESpuro-modified with gateway cassette by recombination clonin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin x 2026-08-15 01:12:28 0
E[beta]P
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_24313 EF1alpha-betacatenin(deltaGSK) // SV40-PuroR Mus musculus Ampicillin PMID:20186325 This plasmid requires a 2nd generation lentiviral packaging system. Backbone Marker:Naldini/Trono (Addgene #12252); Backbone Size:6074; Vector Backbone:pRRLSIN.cPPT.PGK-GFP.WPRE ; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin Sites phosphorylated by GSK-3beta have been mutated. S33A, S37A, T41A, S45A 2026-08-15 01:12:31 11
GST-FOXO1
 
Resource Report
Resource Website 		RRID:Addgene_24379 Foxo1 Mus musculus Ampicillin Backbone Size:4968; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:30 0
pFloxin-IRES-Ofd1-Myc
 
Resource Report
Resource Website 		RRID:Addgene_24559 Ofd1 Mus musculus Ampicillin PMID:19966808 Also see the following article: Ofd1, a human disease gene, regulates the length and distal structure of centrioles. Singla V, Romaguera-Ros M, Garcia-Verdugo JM, Reiter JF. Dev Cell. 2010 Mar 16;18(3):410-24.PMID: 20230748 Backbone Size:4501; Vector Backbone:pBluescript; Vector Types:Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-15 01:12:33 0
pcDNA3.1mLCAD_K42R_FLAG
 
Resource Report
Resource Website 		RRID:Addgene_24486 Long chain acyl-CoA dehydrogenase Mus musculus Ampicillin PMID:20203611 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Lys42Arg 2026-08-15 01:12:31 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch