Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pGL3-IRES-miR34a-P6
 
Resource Report
Resource Website
RRID:Addgene_64790 miR-34a promoter P6 Homo sapiens Ampicillin PMID:17540599 Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:18:13 0
pTNS1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_64967 tnsABCD Ampicillin PMID:15908923 Vector Backbone:unknown; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:18:15 2
pUC18R6KT-mini-Tn7T-Km
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_64969 Ampicillin and Kanamycin PMID:15908923 The uncut plasmid runs as a multimer (>10kb). Multimerization often does not impact plasmid function, but may reduce transformation efficiencies. If the monomer is needed, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid. Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18R6KT-mini-Tn7T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:18:14 5
pUC18T-mini-Tn7T-Gm-REP
 
Resource Report
Resource Website
RRID:Addgene_64966 oriR6K Gentamicin PMID:15908923 Genbank Accession #AY884833 Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18T-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 2026-08-15 01:18:14 0
pUC18-mini-Tn7T-Gm-GW
 
Resource Report
Resource Website
RRID:Addgene_64961 Chloramphenicol and Gentamicin PMID:15908923 GenBank Accession # AY737004 Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Gentamicin 2026-08-15 01:18:14 0
pTH1-SaSrtA
 
Resource Report
Resource Website
RRID:Addgene_64973 sortase A Staphylococcus aureus ATCC 10832 Ampicillin PMID:22729808 Backbone Marker:New England Biolabs; Backbone Size:6688; Vector Backbone:pTWIN1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin deleted amino acids 1-59 2026-08-15 01:18:15 0
human syndecan 2 FAAF
 
Resource Report
Resource Website
RRID:Addgene_64972 syndecan 2 Homo sapiens Ampicillin PMID:24662262 Cloning by PCR using oligo (ccactgcttactggcatgcggcgcgcgtggatc) that links the 3' region of CMV promoter of pCDNA3 to the SDC2 signal peptide and the oligo (ctagaaggcacagtcgcagtgatctcataaaatagagacac) that links the polyadenilation site of bovine growth hormone in pcDNA3 to the 3'UTR of SDC2 (FAAF). Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Y179F, S187A, S188A, Y191F 2026-08-15 01:18:14 0
pHL 2057
 
Resource Report
Resource Website
RRID:Addgene_64909 Ampicillin PMID:25982507 Backbone Size:3000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology, E. coli; Bacterial Resistance:Ampicillin 2026-08-15 01:18:14 0
pHL 309
 
Resource Report
Resource Website
RRID:Addgene_64906 Kanamycin PMID:25982507 Backbone Size:3500; Vector Backbone:ColE (from pZ system) + KanR; Vector Types:Bacterial Expression, Synthetic Biology, E. coli; Bacterial Resistance:Kanamycin 2026-08-15 01:18:14 0
pHL 275
 
Resource Report
Resource Website
RRID:Addgene_64905 Kanamycin PMID:25982507 Backbone Size:3000; Vector Backbone:ColE (from pZ system) + KanR; Vector Types:Bacterial Expression, Synthetic Biology, E. coli; Bacterial Resistance:Kanamycin 2026-08-15 01:18:14 0
pHL 1988
 
Resource Report
Resource Website
RRID:Addgene_64908 Kanamycin PMID:25982507 Backbone Size:3500; Vector Backbone:ColE (from pZ system) + KanR; Vector Types:Bacterial Expression, Synthetic Biology, E. coli; Bacterial Resistance:Kanamycin 2026-08-15 01:18:14 0
pTH1-SaSrtA-KA
 
Resource Report
Resource Website
RRID:Addgene_64981 sortase A Staphylococcus aureus ATCC 10832 Ampicillin PMID:22729808 Backbone Marker:New England Biolabs; Backbone Size:6688; Vector Backbone:pTWIN1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin deleted amino acids 1-59, E105K, E108A 2026-08-15 01:18:14 0
pASKt15C+SrtA
 
Resource Report
Resource Website
RRID:Addgene_64983 sortase A Staphylococcus aureus ATCC 10832 Chloramphenicol PMID:25864513 Backbone Marker:IBA; Backbone Size:3211; Vector Backbone:pASK-IBA3 plus; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol deleted amino acids 1-59 2026-08-15 01:18:15 0
pTH1-SaSrtA-Q
 
Resource Report
Resource Website
RRID:Addgene_64980 sortase A Staphylococcus aureus ATCC 10832 Ampicillin PMID:22729808 Backbone Marker:New England Biolabs; Backbone Size:6688; Vector Backbone:pTWIN1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin deleted amino acids 1-59, E108Q 2026-08-15 01:18:15 0
pcDNA3-pnGFP
 
Resource Report
Resource Website
RRID:Addgene_64913 pnGFP Synthetic Ampicillin PMID:24059533 Please cite Z. Chen, W. Ren, Q.E. Wright and H-w. Ai*, J. Am. Chem. Soc., 2013, 135: 14940-14943. Backbone Marker:Invitrogen; Backbone Size:5968; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Chromophore tyrosine of the protein mutated to TAG amber codon 2026-08-15 01:18:14 0
pEGFP_TRPM8
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_64879 Transient receptor potential cation channel subfamily M member 8 Rattus norvegicus Kanamycin PMID:25589752 Backbone Size:4727; Vector Backbone:pEGFP_C3; Vector Types:; Bacterial Resistance:Kanamycin 2026-08-15 01:18:14 6
pcDNA3-hsGFP
 
Resource Report
Resource Website
RRID:Addgene_64912 hsGFP Synthetic Ampicillin PMID:25141269 Please cite Z. Chen and H-w. Ai*, Biochemistry, 2014, 53: 5966-5974; and S. Chen, Z. Chen, W. Ren and H-w. Ai*, J. Am. Chem. Soc., 2012, 134: 9589-9592. Please note that you will also need a pMAH plasmid for mammalian expression. pMAH-POLY (Z. Chen, W. Ren, Q.E. Wright and H-w. Ai*, J. Am. Chem. Soc., 2013, 135: 14940-14943.) is also deposited to Addgene, which can be used to replace pMAH-AzF for mammalian applications. Backbone Marker:Invitrogen; Backbone Size:5968; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Chromophore tyrosine of the protein mutated to TAG amber codon 2026-08-15 01:18:14 0
pBAD-hsGFP
 
Resource Report
Resource Website
RRID:Addgene_64911 hsGFP Synthetic Ampicillin PMID:25141269 Please cite: Z. Chen and H-w. Ai*, Biochemistry, 2014, 53: 5966-5974; and S. Chen, Z. Chen, W. Ren and H-w. Ai*, J. Am. Chem. Soc., 2012, 134: 9589-9592. For E. coli expression, you will also need pEVOL-pAzF (Addgene # 31186): https://www.addgene.org/31186/ Backbone Marker:Invitrogen; Backbone Size:3954; Vector Backbone:pBAD/HisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Chromophore tyrosine of the protein mutated to TAG amber codon 2026-08-15 01:18:14 0
pCaSpeR4 cyto Grx1-roGFP2
 
Resource Report
Resource Website
RRID:Addgene_64999 Glutaredoxin-1 Homo sapiens Ampicillin PMID:22100409 Sequence discrepancies found during QC should not affect function Vector Backbone:pCaSpeR4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:15 0
pLPCX mito roGFP2-Orp1
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_64992 Orp1 Saccharomyces cerevisiae Ampicillin PMID:19755417 Backbone Marker:Clontech; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin mitochondrial targeting sequence 2026-08-15 01:18:14 10

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.