Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:mus musculus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

12,959 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pGL2B -688/+64
 
Resource Report
Resource Website 		RRID:Addgene_24944 IL-10 promoter Mus musculus Ampicillin PMID:10657644 Backbone Marker:Promega; Backbone Size:5597; Vector Backbone:pGL2B; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:12:35 0
MSCVhygro-F-Ezh2-F667I
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24927 Ezh2 Mus musculus Ampicillin PMID:20368440 Backbone Size:7000; Vector Backbone:MSCV hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin Phenylanaline(F)667 mutated to Isoleucine(I) 2026-08-15 01:12:35 2
FGF10-luciferase
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24994 Fgf10 promoter Mus musculus Ampicillin PMID:12490567 Backbone Marker:ATTC; Backbone Size:6100; Vector Backbone:pXP1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:12:37 1
pCS2 xenopus twisted gastrulation
 
Resource Report
Resource Website 		RRID:Addgene_24974 twisted gastrulation Mus musculus Ampicillin PMID:11714670 mRNA injection sense: cut with NotI, transcribe with SP6 Contains the Xenopus Chordin signal peptide and the N terminus until Ala41, followed by a Flag tag sequence. Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:37 0
pAL119-hCTLA4-Ig
 
Resource Report
Resource Website 		RRID:Addgene_25100 ytotoxic T-murine Lymphocyte Antigen 4 Mus musculus Ampicillin PMID:12515725 Backbone Size:7337; Vector Backbone:pAL119; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:37 0
pmSfrp2
 
Resource Report
Resource Website 		RRID:Addgene_31249 Sfrp2 Mus musculus Ampicillin PMID:9096311 For Riboprobe, cut with XbaI. Runoffs with T7 polymerase. This construct was used in Assimacopoulos et al, J Neurosci. 2003 (PMID: 12878679). Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript SK; Vector Types:cDNA for in situ hybridization; Bacterial Resistance:Ampicillin 2026-08-15 01:13:30 0
pmTUBB3
 
Resource Report
Resource Website 		RRID:Addgene_31236 TUBB3 Mus musculus Ampicillin PMID:9584130 For riboprobes, cut with BamHI. Runoffs with T7. Backbone Size:3000; Vector Backbone:pBluescript SK(+); Vector Types:cDNA for in situ hybridization; Bacterial Resistance:Ampicillin 3'UTR sequence 2026-08-15 01:13:30 0
pCKFB1
 
Resource Report
Resource Website 		RRID:Addgene_31280 Clock Mus musculus Ampicillin PMID:21613214 Backbone Marker:Invitrogen; Backbone Size:4856; Vector Backbone:pFastBacHTa; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:34 0
pMC1SG5
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31282 Cry1 Mus musculus Ampicillin PMID:21613214 Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:30 2
pBMFB2
 
Resource Report
Resource Website 		RRID:Addgene_31278 Bmal1 Mus musculus Ampicillin PMID:21613214 Backbone Marker:Invitrogen; Backbone Size:4775; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:33 0
pBP2MF
 
Resource Report
Resource Website 		RRID:Addgene_31279 Per2 Mus musculus Ampicillin PMID:21613214 Backbone Marker:Invitrogen; Backbone Size:4775; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:30 0
MSCV-Nkx2-1*/Neo
 
Resource Report
Resource Website 		RRID:Addgene_31272 Nkx2-1* Mus musculus Ampicillin PMID:21471965 Backbone Marker:Clontech; Backbone Size:6500; Vector Backbone:pMSCVNeo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin A shNkx2-1 insensitive Nkx2-1 cDNA was created by engineering four silent mutations using QuikChange® Lightning Site-Directed Mutagenesis (Stratagene) and the following primers: 5’ GGTCCGACCATAAAGCAAAGTGGAGCAGGACATGGCGCCATAGTCCGAG 3’ 5’ CTCGGACTATGGCGCCATGTCCTGCTCCACTTTGCTTTATGGTCGGACC 3’ followed by sequence verification and cloning into the MSCV-Puro retroviral expression vector. 2026-08-15 01:13:33 0
pCKPC4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31366 Clock Mus musculus Ampicillin PMID:21613214 Backbone Size:5100; Vector Backbone:pcDNA4a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:34 1
pC1BA
 
Resource Report
Resource Website 		RRID:Addgene_31368 Cry1 Mus musculus Ampicillin PMID:21613214 Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:13:35 0
pBMPC3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31367 Bmal1 Mus musculus Ampicillin PMID:21613214 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:31 8
pCHNFI-X2
 
Resource Report
Resource Website 		RRID:Addgene_31402 Nuclear Factor IX isoform 2 Mus musculus Ampicillin PMID:9660824 Backbone Marker:MacGregor and Caskey; Backbone Size:3771; Vector Backbone:pCMVbeta; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:31 0
pBC1FG
 
Resource Report
Resource Website 		RRID:Addgene_31346 Cry1 Mus musculus Ampicillin PMID:21613214 Backbone Marker:Invitrogen; Backbone Size:4856; Vector Backbone:pFastBacHTa; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:31 0
MDH1-miR-196a-2-PGK-GFP-Blast
 
Resource Report
Resource Website 		RRID:Addgene_31511 miR-196a2 Mus musculus Ampicillin PMID:21451113 Backbone Size:0; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:13:37 0
MDH1-miR-196a-1SM-PGK-GFP-Blast
 
Resource Report
Resource Website 		RRID:Addgene_31510 miR-196a1 Mus musculus Ampicillin PMID:21451113 Backbone Size:0; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin seed mutant control 2026-08-15 01:13:33 0
MDH1-miR-196b-PGK-GFP-Blast
 
Resource Report
Resource Website 		RRID:Addgene_31513 miR-196b Mus musculus Ampicillin PMID:21451113 Backbone Size:0; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:13:33 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch