Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: MRLC2
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23870127
Proper citation: RRID:Addgene_46358 Copy
Species: Gallus gallus
Genetic Insert: Vcl 884-1066
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: YFP subcloned into 15b/V884-1066 (Addgene plasmid 46176) via a PCR strategy which placed Nde sites at the ends of the YFP cDNA and added the spacer region in EGFPC1/V1-1066 at the Cterminus of YFP.
Proper citation: RRID:Addgene_46181 Copy
Species: Homo sapiens
Genetic Insert: leucyl tRNA synthetase
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23723238
Proper citation: RRID:Addgene_46341 Copy
Species: Homo sapiens
Genetic Insert: Depdc5
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23723238
Proper citation: RRID:Addgene_46340 Copy
Species: Homo sapiens
Genetic Insert: Nck
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 37 kDa
Proper citation: RRID:Addgene_46457 Copy
Species: Homo sapiens
Genetic Insert: Lyn
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 38 kDa
Proper citation: RRID:Addgene_46452 Copy
Species: Homo sapiens
Genetic Insert: Grb7
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 38.7 kDa
Proper citation: RRID:Addgene_46444 Copy
Species: Homo sapiens
Genetic Insert: Hck
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 38.5 kDa
Proper citation: RRID:Addgene_46445 Copy
Species: Homo sapiens
Genetic Insert: Grb2
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 48.6 kDa
Proper citation: RRID:Addgene_46442 Copy
Species: Homo sapiens
Genetic Insert: Eat2
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 39.6 kDa
Proper citation: RRID:Addgene_46423 Copy
Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(-)B/myc-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18320585
Comments: EWS cDNA was amplified by PCR using XhoI-NotI-forward and EcoRI-reverse primers 5-TCTCTCGAGCG
GCCGCGCCACCATGGCGTCCACGGATTACAGTACC-3
5-CCGAATTCGTAGGGCCGATCTCTGCGCTCCTG-3, respectively.
Proper citation: RRID:Addgene_46386 Copy
Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX-6p-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16044463
Comments: The EWS cDNA23 was PCR-amplified using primers
ATCTGGAATTCAAATGGCGTCCACGGATTACAGTACCTATAGCCAAGCTGCAGC and CTGGTAGTCAATGCAGCTCGAGGGGGTCTCTGCATCTAGTAGG.
Proper citation: RRID:Addgene_46384 Copy
Species: Homo sapiens
Genetic Insert: Crk
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 38.9 kDa
Proper citation: RRID:Addgene_46418 Copy
Species: Homo sapiens
Genetic Insert: Blnk
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 39.5 kDa
Proper citation: RRID:Addgene_46408 Copy
Species: E. coli
Genetic Insert: Streptavidin-Glutamate_Tag
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:pET21; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24056174
Proper citation: RRID:Addgene_46367 Copy
Vector Backbone Description: Vector Backbone:pUC/2 micrometer plasmid; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24058528
Proper citation: RRID:Addgene_46365 Copy
Species: Homo sapiens
Genetic Insert: EB1
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23870127
Proper citation: RRID:Addgene_46364 Copy
Species: Homo sapiens
Genetic Insert: 4.1G C-terminal domain
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23870127
Comments: Neuromodulin N-terminal sequence is MLCCMRRTKQVEKNDDDQKI
Proper citation: RRID:Addgene_46362 Copy
Species: Homo sapiens
Genetic Insert: PLCg1(NC)
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 48.2 kDa
Proper citation: RRID:Addgene_46471 Copy
Species: S. pyogenes
Genetic Insert: tracrRNA
Vector Backbone Description: Vector Backbone:pACYC184; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:23761437
Proper citation: RRID:Addgene_46570 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
