Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 15 showing 281 ~ 300 out of 33,857 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_46048

    This resource has 1+ mentions.

http://www.addgene.org/46048

Species: Mus musculus
Genetic Insert: Notch1 (C-term)
Vector Backbone Description: Backbone Marker:Invitrogen ; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22797301

Proper citation: RRID:Addgene_46048 Copy   


  • RRID:Addgene_46073

http://www.addgene.org/46073

Species: Mus musculus
Genetic Insert: Map7D1-1333-end
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22425998

Proper citation: RRID:Addgene_46073 Copy   


http://www.addgene.org/46075

Species: Mus musculus
Genetic Insert: Map7-Start-1351
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22425998
Comments: Discrepancies between the Addgene QC sequence and full sequence do not affect function.

Proper citation: RRID:Addgene_46075 Copy   


  • RRID:Addgene_46076

    This resource has 1+ mentions.

http://www.addgene.org/46076

Species: Mus musculus
Genetic Insert: Map7-fulllength
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22425998

Proper citation: RRID:Addgene_46076 Copy   


  • RRID:Addgene_41148

    This resource has 1+ mentions.

http://www.addgene.org/41148

Species: Homo sapiens
Genetic Insert: Cep164
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4110; Vector Backbone:pCJW206 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17954613
Comments: PCR was used to amplify a full-length human Cep164 cDNA from clone KIAA1052 (Kazusa DNA Research Institute). The cDNA was subcloned into a mammalian expression vector providing a myc epitope tag and the construct was verified by sequencing.

Proper citation: RRID:Addgene_41148 Copy   


  • RRID:Addgene_41141

    This resource has 1+ mentions.

http://www.addgene.org/41141

Vector Backbone Description: Backbone Marker:Merck; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_41141 Copy   


  • RRID:Addgene_41131

http://www.addgene.org/41131

Vector Backbone Description: Backbone Marker:Merck; Vector Backbone:pRSRDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_41131 Copy   


  • RRID:Addgene_41128

http://www.addgene.org/41128

Vector Backbone Description: Backbone Marker:Merck; Vector Backbone:pRSRDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_41128 Copy   


http://www.addgene.org/41166

Species: Homo sapiens
Genetic Insert: Rootletin
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4700; Vector Backbone:pCJW201 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16203858
Comments: The partial cDNA clones KIAA0445 (Kazusa DNA Research Institute) and IMAGE clone 6150861 (Deutsches Ressourcenzentrum fuer Genomforschung GmbH) were fused, and the complete coding sequence for rootletin was cloned into pBluescript II SK- (Addgene plasmid #41168) and subsequently subcloned into pEGFP-C1 (CLONTECH Laboratories, Inc.). All constructs were confirmed by sequencing.

Proper citation: RRID:Addgene_41166 Copy   


  • RRID:Addgene_41163

    This resource has 1+ mentions.

http://www.addgene.org/41163

Species: Homo sapiens
Genetic Insert: PICH
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17218258
Comments: The complete ORF of PICH (corresponding exactly to FLJ20105; Acc. No. BC111486) was amplified by nested PCR, using a HeLa Marathon library (Clontech laboratories Inc.), and cloned into pEGFP-C1 vector (Clontech laboratories Inc.). The following primer pairs were used: primer pair 1: AAG CTC CAG CTC CAA GCT CC and TGC TTT TTG AGA TCT TTC TTG CC, primer pair 2: GACTCGAGCTATGGAGGCATCCCGAAGGTTTC and GCCCGGGTCAATTGTTATTAAGTTGC. These primers contain Xho1 and Xma1 sites, respectively, used for cloning.

Proper citation: RRID:Addgene_41163 Copy   


  • RRID:Addgene_41152

    This resource has 1+ mentions.

http://www.addgene.org/41152

Species: Homo sapiens
Genetic Insert: Cep215
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4110; Vector Backbone:pCJW206 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18042621
Comments: The Cep215 cDNA sequence was obtained from KIAA1633 clone (from Kazusa DNA Research Institute). Using PCR, a frameshift within the sequence was corrected and missing 5' coding information was obtained by PCR amplification from Marathon cDNA library (Clontech). Constructs were fused to yield the complete coding sequence of Cep215, and subcloned into a mammalian expression vector providing a Myc epitope-tag. All constructs were confirmed by sequencing.

Proper citation: RRID:Addgene_41152 Copy   


http://www.addgene.org/41151

Species: Homo sapiens
Genetic Insert: Cep170
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4700; Vector Backbone:pEGFP-T7/C1 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15616186
Comments: The KIAA0470 cDNA was obtained from the Kazusa DNA Research Institute. It was subcloned into pT7-EGFP-C1 (modified from pEGFP-C1; BD Biosciences Clontech), after removing the ATG. Specifically, a 5kb SalI-SnaBI (Klenow blunted) fragment from pBS/KIAA0470Δ5'UTR was ligated into pT7-EGFP-C1 (Nigg COM81) digested with XhoI (Klenow blunted). The 3' XhoI site was recreated. This resulted in Addgene plasmid #41150: pEGFP Cep170 (Nigg PID200). The plasmid was then digested with BspEI and XmnI, blunted, and religated to recover a plasmid containing only the Cep170 C-terminal portion (aa 755-1460, from XmnI site to the end of cDNA).

Proper citation: RRID:Addgene_41151 Copy   


  • RRID:Addgene_41189

http://www.addgene.org/41189

Vector Backbone Description: Backbone Size:3200; Vector Backbone:pRS417; Vector Types:Bacteria-Yeas Shuttle; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17908693

Proper citation: RRID:Addgene_41189 Copy   


  • RRID:Addgene_41437

    This resource has 1+ mentions.

http://www.addgene.org/41437

Species: E. coli
Genetic Insert: LexAp65
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2551; Vector Backbone:pDONR P5-P2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_41437 Copy   


  • RRID:Addgene_41436

http://www.addgene.org/41436

Species: Neurospora crassa
Genetic Insert: 10XQUAS
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2551; Vector Backbone:pDONR P1-P4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_41436 Copy   


http://www.addgene.org/41434

Species: E.coli
Genetic Insert: 13XLexAop2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2603; Vector Backbone:pDONR P1-P4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_41434 Copy   


  • RRID:Addgene_41389

    This resource has 1+ mentions.

http://www.addgene.org/41389

Species: Homo sapiens
Genetic Insert: RIP1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19524513

Proper citation: RRID:Addgene_41389 Copy   


  • RRID:Addgene_41384

    This resource has 1+ mentions.

http://www.addgene.org/41384

Species: Mus musculus
Genetic Insert: RIP3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19524513

Proper citation: RRID:Addgene_41384 Copy   


  • RRID:Addgene_41383

http://www.addgene.org/41383

Species: Mus musculus
Genetic Insert: RIP3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19524513

Proper citation: RRID:Addgene_41383 Copy   


  • RRID:Addgene_41565

    This resource has 1+ mentions.

http://www.addgene.org/41565

Species: Homo sapiens
Genetic Insert: SIRT6
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/3PKI/

Proper citation: RRID:Addgene_41565 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X