Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:kanamycin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

33,834 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pENTR-NICD1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46048 Notch1 (C-term) Mus musculus Kanamycin PMID:22797301 Backbone Marker:Invitrogen ; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin Cytoplasmic domain initiating at amino acid 1753 2026-08-15 01:15:28 4
pEGFP-Map7-1333-end
 
Resource Report
Resource Website 		RRID:Addgene_46073 Map7D1-1333-end Mus musculus Kanamycin PMID:22425998 Backbone Marker:Clontech; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:28 0
pEGFP-Map7-Start-1351
 
Resource Report
Resource Website 		RRID:Addgene_46075 Map7-Start-1351 Mus musculus Kanamycin PMID:22425998 Discrepancies between the Addgene QC sequence and full sequence do not affect function. Backbone Marker:Clontech; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:29 0
pEGFP-Map7-fulllength
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46076 Map7-fulllength Mus musculus Kanamycin PMID:22425998 Backbone Marker:Clontech; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:29 2
pRcCMV Cep164 (Nigg CW325)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41148 Cep164 Homo sapiens Kanamycin PMID:17954613 PCR was used to amplify a full-length human Cep164 cDNA from clone KIAA1052 (Kazusa DNA Research Institute). The cDNA was subcloned into a mammalian expression vector providing a myc epitope tag and the construct was verified by sequencing. Backbone Marker:Modified from Clontech; Backbone Size:4110; Vector Backbone:pCJW206 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:42 2
pOPINA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41141 Kanamycin Backbone Marker:Merck; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:42 1
pOPINRSE
 
Resource Report
Resource Website 		RRID:Addgene_41131 Kanamycin Backbone Marker:Merck; Vector Backbone:pRSRDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:42 0
pOPINRSF
 
Resource Report
Resource Website 		RRID:Addgene_41128 Kanamycin Backbone Marker:Merck; Vector Backbone:pRSRDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:42 0
pEGFP Rootletin (Nigg pFL2(CW499))
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41166 Rootletin Homo sapiens Kanamycin PMID:16203858 The partial cDNA clones KIAA0445 (Kazusa DNA Research Institute) and IMAGE clone 6150861 (Deutsches Ressourcenzentrum fuer Genomforschung GmbH) were fused, and the complete coding sequence for rootletin was cloned into pBluescript II SK- (Addgene plasmid #41168) and subsequently subcloned into pEGFP-C1 (CLONTECH Laboratories, Inc.). All constructs were confirmed by sequencing. Backbone Marker:Modified from Clontech; Backbone Size:4700; Vector Backbone:pCJW201 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:42 5
pEGFP PICH (Nigg CB62)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41163 PICH Homo sapiens Kanamycin PMID:17218258 The complete ORF of PICH (corresponding exactly to FLJ20105; Acc. No. BC111486) was amplified by nested PCR, using a HeLa Marathon library (Clontech laboratories Inc.), and cloned into pEGFP-C1 vector (Clontech laboratories Inc.). The following primer pairs were used: primer pair 1: AAG CTC CAG CTC CAA GCT CC and TGC TTT TTG AGA TCT TTC TTG CC, primer pair 2: GACTCGAGCTATGGAGGCATCCCGAAGGTTTC and GCCCGGGTCAATTGTTATTAAGTTGC. These primers contain Xho1 and Xma1 sites, respectively, used for cloning. Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:42 5
pRcCMV Cep215 (Nigg CW493)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41152 Cep215 Homo sapiens Kanamycin PMID:18042621 The Cep215 cDNA sequence was obtained from KIAA1633 clone (from Kazusa DNA Research Institute). Using PCR, a frameshift within the sequence was corrected and missing 5' coding information was obtained by PCR amplification from Marathon cDNA library (Clontech). Constructs were fused to yield the complete coding sequence of Cep215, and subcloned into a mammalian expression vector providing a Myc epitope-tag. All constructs were confirmed by sequencing. Backbone Marker:Modified from Clontech; Backbone Size:4110; Vector Backbone:pCJW206 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:42 4
pEGFP Cep170 C-term (Nigg GG2)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41151 Cep170 Homo sapiens Kanamycin PMID:15616186 The KIAA0470 cDNA was obtained from the Kazusa DNA Research Institute. It was subcloned into pT7-EGFP-C1 (modified from pEGFP-C1; BD Biosciences Clontech), after removing the ATG. Specifically, a 5kb SalI-SnaBI (Klenow blunted) fragment from pBS/KIAA0470Δ5'UTR was ligated into pT7-EGFP-C1 (Nigg COM81) digested with XhoI (Klenow blunted). The 3' XhoI site was recreated. This resulted in Addgene plasmid #41150: pEGFP Cep170 (Nigg PID200). The plasmid was then digested with BspEI and XmnI, blunted, and religated to recover a plasmid containing only the Cep170 C-terminal portion (aa 755-1460, from XmnI site to the end of cDNA). Backbone Marker:Modified from Clontech; Backbone Size:4700; Vector Backbone:pEGFP-T7/C1 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Contains C-terminal fragment (aa 755-1460, from XmnI site to the end of cDNA), 2026-08-15 01:14:42 1
pRNDM
 
Resource Report
Resource Website 		RRID:Addgene_41189 Kanamycin PMID:17908693 Backbone Size:3200; Vector Backbone:pRS417; Vector Types:Bacteria-Yeas Shuttle; Bacterial Resistance:Kanamycin 2026-08-15 01:14:42 0
L5-LexAp65-L2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41437 LexAp65 E. coli Kanamycin Backbone Marker:Invitrogen; Backbone Size:2551; Vector Backbone:pDONR P5-P2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:45 1
L1-10XQUAS-L4
 
Resource Report
Resource Website 		RRID:Addgene_41436 10XQUAS Neurospora crassa Kanamycin Backbone Marker:Invitrogen; Backbone Size:2551; Vector Backbone:pDONR P1-P4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:45 0
pENTR L1-13XLexAop2-L4
 
Resource Report
Resource Website 		RRID:Addgene_41434 13XLexAop2 E.coli Kanamycin Backbone Marker:Invitrogen; Backbone Size:2603; Vector Backbone:pDONR P1-P4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:45 0
hRIP1 HA GFP K45A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41389 RIP1 Homo sapiens Kanamycin PMID:19524513 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Kinase Domain Mutant (K45A) 2026-08-15 01:14:45 1
mRIP3 GFP RHIM mut
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41384 RIP3 Mus musculus Kanamycin PMID:19524513 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin RHIM mutant 2026-08-15 01:14:45 1
mRIP3 GFP D161N
 
Resource Report
Resource Website 		RRID:Addgene_41383 RIP3 Mus musculus Kanamycin PMID:19524513 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Kinase Domain Mutant (D161N) 2026-08-15 01:14:45 0
SIRT6
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41565 SIRT6 Homo sapiens Kanamycin http://www.thesgc.org/structures/3PKI/ Backbone Marker:SGC; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin aa 3-353 2026-08-15 01:14:46 3

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch