Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Mentions:yes (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pTK96_mCherry-MRLC2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46358 MRLC2 Homo sapiens Ampicillin PMID:23870127 Backbone Size:6000; Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:31 1
pET15b/EYFP-GgVcl 884-1066 (Vt)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46181 Vcl 884-1066 Gallus gallus Ampicillin YFP subcloned into 15b/V884-1066 (Addgene plasmid 46176) via a PCR strategy which placed Nde sites at the ends of the YFP cDNA and added the spacer region in EGFPC1/V1-1066 at the Cterminus of YFP. Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin aa 884-1066 (tail domain) 2026-08-15 01:15:29 1
Flag Leucyl tRNA synthetase pRK5
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46341 leucyl tRNA synthetase Homo sapiens Ampicillin PMID:23723238 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:30 2
Flag Depdc5 pRK5
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46340 Depdc5 Homo sapiens Ampicillin PMID:23723238 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Differs from Depdc5 isoform 1 by 10 amino acids starting at position 724: ILTLSAPPVV 2026-08-15 01:15:31 5
pGEX Nck-SH2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46457 Nck Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 37 kDa Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 275-377 2026-08-15 01:15:32 1
pGEX Lyn-SH2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46452 Lyn Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 38 kDa Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 106-213 2026-08-15 01:15:32 1
pGEX Grb7-SH2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46444 Grb7 Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 38.7 kDa Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 417-532 2026-08-15 01:15:32 1
pGEX Hck-SH2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46445 Hck Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 38.5 kDa Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 134-254 2026-08-15 01:15:31 1
pGEX Grb2 SH2-SH3
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46442 Grb2 Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 48.6 kDa Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 1-217 2026-08-15 01:15:31 3
pGEX Eat2-SH2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46423 Eat2 Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 39.6 kDa Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 1-132 2026-08-15 01:15:32 1
pcDNA3.1 EWS-myc-HIS
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46386 EWSR1 Homo sapiens Ampicillin PMID:18320585 EWS cDNA was amplified by PCR using XhoI-NotI-forward and EcoRI-reverse primers 5-TCTCTCGAGCG GCCGCGCCACCATGGCGTCCACGGATTACAGTACC-3 5-CCGAATTCGTAGGGCCGATCTCTGCGCTCCTG-3, respectively. Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(-)B/myc-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:31 1
pGEX-6p-2-EWSR1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46384 EWSR1 Homo sapiens Ampicillin PMID:16044463 The EWS cDNA23 was PCR-amplified using primers ATCTGGAATTCAAATGGCGTCCACGGATTACAGTACCTATAGCCAAGCTGCAGC and CTGGTAGTCAATGCAGCTCGAGGGGGTCTCTGCATCTAGTAGG. Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX-6p-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:31 1
pGEX Crk-SH2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46418 Crk Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 38.9 kDa Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 1-124 2026-08-15 01:15:31 2
pGEX Blnk-SH2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46408 Blnk Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 39.5 kDa Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 333-456 2026-08-15 01:15:31 2
pET21-Streptavidin-Glutamate_Tag
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_46367 Streptavidin-Glutamate_Tag E. coli Ampicillin PMID:24056174 Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:pET21; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:31 14
pRTVIR
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46365 Ampicillin PMID:24058528 Vector Backbone:pUC/2 micrometer plasmid; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:15:31 1
pCB150-2_GFP-EB1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46364 EB1 Homo sapiens Ampicillin PMID:23870127 Backbone Size:6000; Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:31 1
pTK165_Mem-mCherry-4.1G-CTD
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46362 4.1G C-terminal domain Homo sapiens Kanamycin PMID:23870127 Neuromodulin N-terminal sequence is MLCCMRRTKQVEKNDDDQKI Backbone Size:4000; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin C-terminal domain from 886-1005 amino acids 2026-08-15 01:15:31 3
pGEX PLCg1(NC)-SH2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46471 PLCg1(NC) Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 48.2 kDa Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 542-759 2026-08-15 01:15:32 1
pWJ66
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46570 tracrRNA S. pyogenes Chloramphenicol PMID:23761437 Vector Backbone:pACYC184; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol 2026-08-15 01:15:33 4

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.