Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: ChETA-TdTomato
Vector Backbone Description: Backbone Marker:K. Deisseroth Lab; Backbone Size:5435; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Off; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22866029
Proper citation: RRID:Addgene_37089 Copy
Species: Synthetic
Genetic Insert: EGFP
Vector Backbone Description: Backbone Marker:K. Deisseroth Lab; Backbone Size:5603; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-On; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22866029
Proper citation: RRID:Addgene_37084 Copy
Species: Synthetic
Genetic Insert: EGFP
Vector Backbone Description: Backbone Marker:K. Deisseroth Lab; Backbone Size:5613; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Off; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22866029
Proper citation: RRID:Addgene_37085 Copy
Species: Synthetic
Genetic Insert: NpHR3.0-EYFP
Vector Backbone Description: Backbone Marker:K. Deisseroth Lab; Backbone Size:5613; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Off; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22866029
Proper citation: RRID:Addgene_37087 Copy
Species: Synthetic
Genetic Insert: d1eGFP
Vector Backbone Description: Backbone Marker:K. Deisseroth Lab; Backbone Size:5435; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Off; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22866029
Proper citation: RRID:Addgene_37091 Copy
Species: Synthetic
Genetic Insert: TdTomato
Vector Backbone Description: Backbone Marker:K. Deisseroth Lab; Backbone Size:5435; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Off; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22866029
Proper citation: RRID:Addgene_37092 Copy
Species: WU polyomavirus
Genetic Insert: WU polyomavirus early region
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5535; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17480120
Proper citation: RRID:Addgene_37094 Copy
Species: Mus musculus
Genetic Insert: Mib1(Mus musculus mindbomb homolog 1 (Drosophila) (Mib1))
Vector Backbone Description: Backbone Marker:Agilent (Stratagene); Backbone Size:4319; Vector Backbone:pCMV-Tag4a; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21903422
Proper citation: RRID:Addgene_37116 Copy
Species: Mus musculus
Genetic Insert: Hb9 GFP
Vector Backbone Description: Backbone Marker:Inder Verma lab; Backbone Size:8466; Vector Backbone:CSCspPW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19041781
Comments: Expresses GFP under the control of the Hb9 promoter to visualize postmitotic human motor neurons
Proper citation: RRID:Addgene_37080 Copy
Species: Synthetic
Genetic Insert: hChr2(H134R)-mCherry
Vector Backbone Description: Backbone Marker:K. Deisseroth Lab; Backbone Size:5613; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Off; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22660328
Proper citation: RRID:Addgene_37082 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:K. Deisseroth Lab; Backbone Size:5603; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-On; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22866029
Proper citation: RRID:Addgene_37083 Copy
Species: Homo sapiens
Genetic Insert: EDD
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4373; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12011095
Comments: Addgene NGS results identified a K503R mutation within the UBR5 translation. There is no information on the functional consequence of this mutation
Proper citation: RRID:Addgene_37188 Copy
Vector Backbone Description: Backbone Size:6025; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
2K-T has a TEV-cleavable N-terminal His6 and MBP fusion tag to enhance solubility and ease purification. These tags are preceded by a periplasmic locator signal, which is autocleaved during secretion. The PPL tag may be helpful if your protein binds to or interferes with intracellular E. coli molecules, since your protein of interest is safely sequestered in the periplasm. It may also be helpful if your protein of interest is more stable in the periplasmic environment. Protein purification may also be made simpler using this expression method.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_37183 Copy
Vector Backbone Description: Backbone Marker:CLONTECH; Backbone Size:4810; Vector Backbone:pDIRECT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747757
Comments: For more information on Pelczar TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#pelczar
Proper citation: RRID:Addgene_37184 Copy
Species: Homo sapiens
Genetic Insert: EDD
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4708; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12011095
Proper citation: RRID:Addgene_37190 Copy
Species: Mus musculus
Genetic Insert: mouse ZO-1 shRNA
Vector Backbone Description: Backbone Size:7700; Vector Backbone:pLL5.0; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Comments: pLL5.0 derived from pLL3.7; CMV promoter replaced with 5' LTR promoter from pMSCV.
Proper citation: RRID:Addgene_37215 Copy
Species: canine
Genetic Insert: dog ZO-1 shRNA
Vector Backbone Description: Backbone Size:3176; Vector Backbone:pSUPER; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19605556
Proper citation: RRID:Addgene_37206 Copy
Species: Homo sapiens
Genetic Insert: A2BR
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21628448
Comments: A2B was PCR amplified as a 1068bp fragment incorporating a 5' EcoRI site. The stop codon was eliminated and a 3' BamHI site was added with the reverse PCR primer to allow direct cloning into pEYFP-N1
Proper citation: RRID:Addgene_37202 Copy
Species: Mus musculus
Genetic Insert: Rosa26 left targeting arm
Vector Backbone Description: Backbone Marker:Sigma; Vector Backbone:pZDonor AAVS1; Vector Types:Genomic targeting - zinc finger; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22169954
Comments: The homology arms in the ROSA26 donor vector were generated by PCR of mouse genomic DNA and insertion of the PCR-amplified right homology arm (left primer: 5-TTATTGCGGCCGCAG ATGGGCGGGAGTCTTCT-3, right primer: 5-AACA CCGCGGCAGTTTATAAATGGAGAAAAAGGAGA -3) between the NotI and SacII sites and the left homology arm (left primer: 5-TCTATGGTACCAGTTAACGGCA GCCGGAGT-3 , right primer: 5 -CGGACGAATTCTCT AGAAAGACTGGAGTTGCAGA-3) between the KpnI and EcoRI sites in the pZDonor AAVS1 vector obtained from Sigma–Aldrich.
Proper citation: RRID:Addgene_37200 Copy
Species: Homo sapiens
Genetic Insert: lig4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4776; Vector Backbone:pFASTBAC1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_37150 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
