Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:danio rerio (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

2,192 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
TAL3192
 
Resource Report
Resource Website
RRID:Addgene_41366 ZebrafishCommunity-tfeb-Left Danio rerio Ampicillin PMID:21822241 Target binding site: TTGGATGTGTACACGGGG It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:45 0
GoldyTALEN-cdh5 TAL1
 
Resource Report
Resource Website
RRID:Addgene_41833 cadherin 5 Danio rerio Ampicillin PMID:23000899 The cdh5 TALEN recognition sequences are: left TALEN 5′-CTCCTCAACATACATACT-3′ and right TALEN 5′-ACAAATGATTCATCTT-3′. Between the two binding sites is a 16-bp spacer containing a HincII site (GGAGAGTTAGTTGACA). See Addgene plasmid# 41834 and the associated publication for more information. Backbone Marker:Dan Carlson (Addgene plasmid# 38142); Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:cloning vector; Bacterial Resistance:Ampicillin 2026-08-15 01:14:48 0
Zebrafish-gRNA-0008
 
Resource Report
Resource Website
RRID:Addgene_42248 gRNA-tia1l Danio rerio Kanamycin PMID:23360964 Target site: GGTATGTCGGGAACCTCTCC Guide RNA sequence: TAATACGACTCACTATAGGTATGTCGGGAACCTCTCCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:52 0
Zebrafish-gRNA-0002
 
Resource Report
Resource Website
RRID:Addgene_42242 gRNA-drd3 Danio rerio Kanamycin PMID:23360964 Target site: GGAAACTACAGCCCAGCGTC Guide RNA sequence: TAATACGACTCACTATAGGAAACTACAGCCCAGCGTCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:51 0
Zebrafish-gRNA-0003
 
Resource Report
Resource Website
RRID:Addgene_42243 gRNA-fh site #1 Danio rerio Kanamycin PMID:23360964 Target site: GGAGCGGTACATGGCGACCG Guide RNA sequence: TAATACGACTCACTATAGGAGCGGTACATGGCGACCGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:51 0
Zebrafish-gRNA-0006
 
Resource Report
Resource Website
RRID:Addgene_42246 gRNA-rgs4 Danio rerio Kanamycin PMID:23360964 Target site: GGAGAAGGTGAAGGACACTG Guide RNA sequence: TAATACGACTCACTATAGGAGAAGGTGAAGGACACTGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:51 0
Tol2-zTRAP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_42236 EGFP-Rpl10a Danio rerio Ampicillin PMID:23281262 Backbone Size:6170; Vector Backbone:pT2KXIG; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:14:51 1
RCIscript-GoldyTALEN-ponzr1R
 
Resource Report
Resource Website
RRID:Addgene_42655 ponzr1 right pTAL scaffold Danio rerio Ampicillin PMID:23000899 Backbone Marker:Addgene plasmid 38142; Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:mRNA transcription vector; Bacterial Resistance:Ampicillin 2026-08-15 01:14:55 0
TAL3228
 
Resource Report
Resource Website
RRID:Addgene_42691 ZebrafishCommunity-cited2-left Danio rerio Ampicillin PMID:21822241 Target binding site: TGGTAGACCGCATGATGG It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:56 0
TAL3229
 
Resource Report
Resource Website
RRID:Addgene_42692 ZebrafishCommunity-cited2-right Danio rerio Ampicillin PMID:21822241 Target binding site: TTCACAGCATCTGGGAAA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:56 0
TAL3231
 
Resource Report
Resource Website
RRID:Addgene_42694 ZebrafishCommunity-Complement Factor H-right Danio rerio Ampicillin PMID:21822241 Target binding site: TCCAAAAGGAGGTGGACA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:56 0
TAL3232
 
Resource Report
Resource Website
RRID:Addgene_42695 ZebrafishCommunity-crispld2-left Danio rerio Ampicillin PMID:21822241 Target binding site: TATCAGGAGGAGCTAGAA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:56 0
TAL3233
 
Resource Report
Resource Website
RRID:Addgene_42696 ZebrafishCommunity-crispld2-right Danio rerio Ampicillin PMID:21822241 Target binding site: TTCGGACAGGAGCGTCGG It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:56 0
TAL3234
 
Resource Report
Resource Website
RRID:Addgene_42697 ZebrafishCommunity-dachc-left Danio rerio Ampicillin PMID:21822241 Target binding site: TCCAGACCTGGCAGACCT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:56 0
TAL3235
 
Resource Report
Resource Website
RRID:Addgene_42698 ZebrafishCommunity-dachc-right Danio rerio Ampicillin PMID:21822241 Target binding site: TGTCGGGTGATGTCACAT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:56 0
TAL3225
 
Resource Report
Resource Website
RRID:Addgene_42688 ZebrafishCommunity-cebpb-right Danio rerio Ampicillin PMID:21822241 Target binding site: TTAGTGCTGTGGAAAGCG It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:56 0
TAL3226
 
Resource Report
Resource Website
RRID:Addgene_42689 ZebrafishCommunity-CIT1-left Danio rerio Ampicillin PMID:21822241 Target binding site: TGAAGTTTAAATATGGAG It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:56 0
TAL3221
 
Resource Report
Resource Website
RRID:Addgene_42684 ZebrafishCommunity-avpl-right Danio rerio Ampicillin PMID:21822241 Target binding site: TTCTGGATGTAGCAGGCA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:55 0
TAL3222
 
Resource Report
Resource Website
RRID:Addgene_42685 ZebrafishCommunity-Ccl2-left Danio rerio Ampicillin PMID:21822241 Target binding site: TTTTCGTTTTCCACTATA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:56 0
TAL3214
 
Resource Report
Resource Website
RRID:Addgene_42677 ZebrafishCommunity-arnt1-left Danio rerio Ampicillin PMID:21822241 Target binding site: TCCCGTCTCTGGCCATGA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:55 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.