Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 150 showing 2981 ~ 3000 out of 12,959 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/31514

Species: Mus musculus
Genetic Insert: miR-196b
Vector Backbone Description: Backbone Size:0; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21451113

Proper citation: RRID:Addgene_31514 Copy   


http://www.addgene.org/31509

Species: Mus musculus
Genetic Insert: miR-196a1
Vector Backbone Description: Backbone Size:0; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21451113

Proper citation: RRID:Addgene_31509 Copy   


  • RRID:Addgene_31619

http://www.addgene.org/31619

Species: Mus musculus
Genetic Insert: Smo
Vector Backbone Description: Backbone Marker:Hawley et al., 1994; Backbone Size:7000; Vector Backbone:pMSCV-pac; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19948480

Proper citation: RRID:Addgene_31619 Copy   


  • RRID:Addgene_31618

http://www.addgene.org/31618

Species: Mus musculus
Genetic Insert: Smo
Vector Backbone Description: Backbone Marker:RZPD; Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Worm Expression, Zebrafish, Avian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19948480
Comments: Wild-type mouse Smo was tagged at the N terminus (with the insertion C terminal to the signal sequence) with YFP.

Proper citation: RRID:Addgene_31618 Copy   


  • RRID:Addgene_31617

http://www.addgene.org/31617

Species: Mus musculus
Genetic Insert: Smo
Vector Backbone Description: Backbone Marker:RZPD; Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Worm Expression, Zebrafish, Avian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19948480
Comments: Wild-type mouse Smo was tagged at the N terminus (with the insertion C terminal to the signal sequence) with SNAP.

Proper citation: RRID:Addgene_31617 Copy   


  • RRID:Addgene_31603

http://www.addgene.org/31603

Species: Mus musculus
Genetic Insert: ΔN331 kinesin-1B
Vector Backbone Description: Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19812246

Proper citation: RRID:Addgene_31603 Copy   


  • RRID:Addgene_31605

http://www.addgene.org/31605

Species: Mus musculus
Genetic Insert: kinesin-1C
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4001; Vector Backbone:pEGFP-C1 (EGFP removed); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19812246

Proper citation: RRID:Addgene_31605 Copy   


  • RRID:Addgene_31607

    This resource has 1+ mentions.

http://www.addgene.org/31607

Species: Mus musculus
Genetic Insert: kinesin-1A
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3940; Vector Backbone:pEGFP-C1 (EGFP removed); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19812246

Proper citation: RRID:Addgene_31607 Copy   


  • RRID:Addgene_31606

    This resource has 1+ mentions.

http://www.addgene.org/31606

Species: Mus musculus
Genetic Insert: ΔN335 kinesin-1A
Vector Backbone Description: Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19812246

Proper citation: RRID:Addgene_31606 Copy   


  • RRID:Addgene_31711

http://www.addgene.org/31711

Species: Mus musculus
Genetic Insert: miR-302b, c, a, d
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21454525

Proper citation: RRID:Addgene_31711 Copy   


  • RRID:Addgene_31710

http://www.addgene.org/31710

Species: Mus musculus
Genetic Insert: miR-19b
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21454525

Proper citation: RRID:Addgene_31710 Copy   


  • RRID:Addgene_31708

http://www.addgene.org/31708

Species: Mus musculus
Genetic Insert: miR-92a
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21454525

Proper citation: RRID:Addgene_31708 Copy   


  • RRID:Addgene_31703

    This resource has 1+ mentions.

http://www.addgene.org/31703

Species: Mus musculus
Genetic Insert: miR-106a-363
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21454525
Comments: miR-106a-363 micro RNA sequence - caaagtgctaacagtgcaggtag

Proper citation: RRID:Addgene_31703 Copy   


  • RRID:Addgene_31706

http://www.addgene.org/31706

Species: Mus musculus
Genetic Insert: miR-18b
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21454525

Proper citation: RRID:Addgene_31706 Copy   


  • RRID:Addgene_31871

    This resource has 1+ mentions.

http://www.addgene.org/31871

Species: Mus musculus
Genetic Insert: NLS
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4678; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20212155

Proper citation: RRID:Addgene_31871 Copy   


http://www.addgene.org/31858

Species: Mus musculus
Genetic Insert: nMyc wild-type 3'UTR
Vector Backbone Description: Backbone Size:6273; Vector Backbone:psiCHECK-2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20054295

Proper citation: RRID:Addgene_31858 Copy   


http://www.addgene.org/31859

Species: Mus musculus
Genetic Insert: nMyc mutant-1 3'UTR
Vector Backbone Description: Backbone Size:6273; Vector Backbone:psiCHECK-2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20054295

Proper citation: RRID:Addgene_31859 Copy   


  • RRID:Addgene_31790

    This resource has 1+ mentions.

http://www.addgene.org/31790

Species: Mus musculus
Genetic Insert: Akt1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pENTR1A; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21147110

Proper citation: RRID:Addgene_31790 Copy   


  • RRID:Addgene_31795

    This resource has 1+ mentions.

http://www.addgene.org/31795

Species: Mus musculus
Genetic Insert: TAZ
Vector Backbone Description: Backbone Marker:Drs. S Lessnick and T. Golub (Dana-Farber Cancer Institute); Vector Backbone:pSRP; Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16099986

Proper citation: RRID:Addgene_31795 Copy   


  • RRID:Addgene_31818

    This resource has 1+ mentions.

http://www.addgene.org/31818

Species: Mus musculus
Genetic Insert: MEF2-dependent promoter (-307 to -242 of Nur77/NR4A1)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5600; Vector Backbone:pGL2-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7565789
Comments: The minimal c-fos promoter fragment was cloned into the SmaI and BglII sites of pGL2 basic. The wild-type RSRF sequence of the -307 to -242 Nur77/NR4A1 promoter region was cloned in to the SalI site of this SmaI/BglII fragment.

Proper citation: RRID:Addgene_31818 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X