Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: AOS1
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12761287
Proper citation: RRID:Addgene_16089 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: UBA2
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12761287
Proper citation: RRID:Addgene_16088 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: NFI1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5443; Vector Backbone:pET21b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12761287
Proper citation: RRID:Addgene_16091 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Medium-chain fatty acid ethyl ester synthase
Vector Backbone Description: Vector Backbone:p15A; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32886882
Proper citation: RRID:Addgene_160865 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: MCP-mCherry-MYC tag
Vector Backbone Description: Vector Backbone:psh100; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33037152
Proper citation: RRID:Addgene_160937 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: MCP-mCherry-FLAG tag
Vector Backbone Description: Vector Backbone:psh100; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33037152
Proper citation: RRID:Addgene_160938 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: MCP-Gateway cloning site-HIS tag, 3'UTR MS2 Stem Loop
Vector Backbone Description: Backbone Size:6000; Vector Backbone:psh100; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:33037152
Proper citation: RRID:Addgene_160934 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: pol1
Vector Backbone Description: Vector Backbone:pGST-parallel; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32923642
Proper citation: RRID:Addgene_160991 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: pol1
Vector Backbone Description: Vector Backbone:pGST-parallel; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32923642
Proper citation: RRID:Addgene_160989 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Added HLM1 to the C-terminal end of Dcp2C Δ5H.
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163584 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Added HLM1 to the C-terminal end of Dcp2 FL.
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163583 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Lacking N-terminal domain, which binds RNA and has enzymatic activities.
5' sequenceing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163575 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Impaired Edc3 binding site (first HLM).
5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163576 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: impaired RNA binding. 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163579 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Lacking C-terminal domain, impaired Edc3 binding site (first HLM).
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163578 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Green fluorescent protein - human dihydrofolate reductase (GFP-2A-hDHFR)
Vector Backbone Description: Vector Backbone:pBluescript; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_164574 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: MET3pr - yEVenus - CLN2 PEST - ADH1t
Vector Backbone Description: Vector Backbone:pRS406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37369667
Comments: yEVenus is a codon-optimized yEGFP variant with F46L, S65G, V68L, S72A, M153T, V163A, S175G, and T203Y mutations. Please visit https://www.biorxiv.org/content/10.1101/2020.08.16.253310v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_164710 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ADH1t - tetOpr - yEVenus - CLN2 PEST - ADH1t
Vector Backbone Description: Vector Backbone:pRS406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37369667
Comments: yEVenus is a codon-optimized yEGFP variant with F46L, S65G, V68L, S72A, M153T, V163A, S175G, and T203Y mutations. Please visit https://www.biorxiv.org/content/10.1101/2020.08.16.253310v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_164708 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: PGK1pr - rtTA - CYC1t
Vector Backbone Description: Backbone Marker:Zhou et al, Nature, 2018 PMID: 29562237; Vector Backbone:EZL105; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37369667
Comments: yEVenus is a codon-optimized yEGFP variant with F46L, S65G, V68L, S72A, M153T, V163A, S175G, and T203Y mutations. Please visit https://www.biorxiv.org/content/10.1101/2020.08.16.253310v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_164706 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: PHO5pr - yEVenus - CLN2 PEST - ADH1t
Vector Backbone Description: Vector Backbone:pRS406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37369667
Comments: yEVenus is a codon-optimized yEGFP variant with F46L, S65G, V68L, S72A, M153T, V163A, S175G, and T203Y mutations. Please visit https://www.biorxiv.org/content/10.1101/2020.08.16.253310v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_164704 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
