Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: PSPC1
Vector Backbone Description: Backbone Marker:Brown lab (Addgene plasmid 46339); Vector Backbone:pSCT-GAL93-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22966205
Comments: There is a stop codon before HIS tag in the vector.
Proper citation: RRID:Addgene_46321 Copy
Species: Homo sapiens
Genetic Insert: Depdc5
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23723238
Proper citation: RRID:Addgene_46327 Copy
Species: Homo sapiens
Genetic Insert: SFPQ
Vector Backbone Description: Backbone Marker:Brown lab (Addgene plasmid 46339); Vector Backbone:pSCT-GAL93-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22966205
Comments: There is a stop codon before HIS tag in the vector.
Proper citation: RRID:Addgene_46320 Copy
Species: Gallus gallus
Genetic Insert: Vcl 1-1066
Vector Backbone Description: Backbone Marker:described in N. Kioka. 1999. JCB 144:59-69; Vector Backbone:p401F; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_46284 Copy
Genetic Insert: 5 copies of A9 sequence from Ihh promoter
Vector Backbone Description: Backbone Marker:Yang lab; Vector Backbone:Luc reporter vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19906842
Comments: Five copies of the WT A9 (GATCCAAAGGGAATGTTGCC) were inserted upstream of the TATA box (a 16 bp sequence) from the mouse osteocalcin gene 2 promoter (OG2-TATA box), which is followed by the Luc gene.
Proper citation: RRID:Addgene_46318 Copy
Species: Tomato bushy stunt virus
Genetic Insert: p19
Vector Backbone Description: Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23475073
Comments: IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert.
More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290
Proper citation: RRID:Addgene_46312 Copy
Species: Tomato bushy stunt virus
Genetic Insert: p19
Vector Backbone Description: Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23475073
Comments: IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert.
More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290
Proper citation: RRID:Addgene_46310 Copy
Species: Tomato bushy stunt virus
Genetic Insert: p19
Vector Backbone Description: Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23475073
Comments: IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert.
More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290
Proper citation: RRID:Addgene_46314 Copy
Species: Mus musculus
Genetic Insert: Vimentin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19726676
Proper citation: RRID:Addgene_46315 Copy
Species: Danio rerio
Genetic Insert: Brevican mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20525357
Comments: Please note that Addgene's sequencing results contain a few nucleotide mismatches when compared to the sequence provided by the depositing laboratory. These mismatches do not affect the production of recombinant antibodies, nor the affinity of the antibody for its antigen.
Proper citation: RRID:Addgene_46300 Copy
Species: Danio rerio
Genetic Insert: CD276 mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20525357
Proper citation: RRID:Addgene_46305 Copy
Species: Tomato bushy stunt virus
Genetic Insert: p19
Vector Backbone Description: Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23475073
Proper citation: RRID:Addgene_46306 Copy
Species: Gallus gallus
Genetic Insert: Vcl 1-851
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15728584
Comments: EYFP was PCR amplified to introduce NdeI site at both 5' and 3' ends. The NdeI flanked EYFP was inserted into NdeI site of pET15b/Vh1-851 (Addgene plasmid 46172), cloned between NdeI and XhoI. Plasmid contains a 12-residue spacer between the EYFP and vinculin domain.
Proper citation: RRID:Addgene_46264 Copy
Species: Gallus gallus
Genetic Insert: Vcl 1-258
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15728584
Comments: EYFP was PCR amplified to introduce NdeI site at both 5' and 3' ends. The NdeI flanked EYFP was inserted into NdeI site of pET15b/Vh1-258 (Addgene plasmid 46173), where V1-258 was cloned between NdeI and XhoI. Plasmid contains a 12-residue spacer between the EYFP and vinculin domain.
Proper citation: RRID:Addgene_46263 Copy
Species: Mus musculus
Genetic Insert: carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23429703
Proper citation: RRID:Addgene_46240 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Lifeact
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23870127
Proper citation: RRID:Addgene_46357 Copy
Species: Homo sapiens
Genetic Insert: Anillin
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23870127
Proper citation: RRID:Addgene_46354 Copy
Species: Homo sapiens
Genetic Insert: MRLC2
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23870127
Proper citation: RRID:Addgene_46355 Copy
Species: Homo sapiens
Genetic Insert: MRLC2
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23870127
Proper citation: RRID:Addgene_46358 Copy
Species: Mus musculus
Genetic Insert: Drp1 V2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5378; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23283981
Proper citation: RRID:Addgene_46345 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.