Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:saccharomyces cerevisiae (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

4,486 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pT-59
 
Resource Report
Resource Website 		RRID:Addgene_16089 AOS1 Saccharomyces cerevisiae Ampicillin PMID:12761287 Backbone Size:5000; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:08:49 0
pT-58
 
Resource Report
Resource Website 		RRID:Addgene_16088 UBA2 Saccharomyces cerevisiae Ampicillin PMID:12761287 Backbone Size:5000; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:08:45 0
pT-61
 
Resource Report
Resource Website 		RRID:Addgene_16091 NFI1 Saccharomyces cerevisiae Ampicillin PMID:12761287 Backbone Marker:Novagen; Backbone Size:5443; Vector Backbone:pET21b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:08:45 0
pLNL1134
 
Resource Report
Resource Website 		RRID:Addgene_160865 Medium-chain fatty acid ethyl ester synthase Saccharomyces cerevisiae Kanamycin PMID:32886882 Vector Backbone:p15A; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:08:45 0
plIVMD115
 
Resource Report
Resource Website 		RRID:Addgene_160937 MCP-mCherry-MYC tag Saccharomyces cerevisiae Ampicillin PMID:33037152 Vector Backbone:psh100; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:08:46 0
plIVMD118
 
Resource Report
Resource Website 		RRID:Addgene_160938 MCP-mCherry-FLAG tag Saccharomyces cerevisiae Ampicillin PMID:33037152 Vector Backbone:psh100; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:08:49 0
plIVMD156
 
Resource Report
Resource Website 		RRID:Addgene_160934 MCP-Gateway cloning site-HIS tag, 3'UTR MS2 Stem Loop Saccharomyces cerevisiae Chloramphenicol and Ampicillin PMID:33037152 Backbone Size:6000; Vector Backbone:psh100; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:08:46 0
pGST-pol1-N2-2A2
 
Resource Report
Resource Website 		RRID:Addgene_160991 pol1 Saccharomyces cerevisiae Ampicillin PMID:32923642 Vector Backbone:pGST-parallel; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin F58A/D62A 2026-08-15 01:08:46 0
pGST-pol1-N2
 
Resource Report
Resource Website 		RRID:Addgene_160989 pol1 Saccharomyces cerevisiae Ampicillin PMID:32923642 Vector Backbone:pGST-parallel; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:08:46 0
Dcp2C Δ5H-H1
 
Resource Report
Resource Website 		RRID:Addgene_163584 Dcp2 Saccharomyces cerevisiae Ampicillin PMID:32553117 Added HLM1 to the C-terminal end of Dcp2C Δ5H. 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Truncation of aa1-326; the first HLM (EDQLKSYAEEQLKLLLGITKEE) is added to the C-terminal end 2026-08-15 01:09:13 0
Dcp2 FL-H1
 
Resource Report
Resource Website 		RRID:Addgene_163583 Dcp2 Saccharomyces cerevisiae Ampicillin PMID:32553117 Added HLM1 to the C-terminal end of Dcp2 FL. 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin The first HLM (EDQLKSYAEEQLKLLLGITKEE) is added to the C-terminal end of Dcp2 FL 2026-08-15 01:09:13 0
Dcp2 ΔN
 
Resource Report
Resource Website 		RRID:Addgene_163575 Dcp2 Saccharomyces cerevisiae Ampicillin PMID:32553117 Lacking N-terminal domain, which binds RNA and has enzymatic activities. 5' sequenceing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Truncation of N-terminal domain (1-242) of Dcp2 2026-08-15 01:09:13 0
Dcp2 ΔH1
 
Resource Report
Resource Website 		RRID:Addgene_163576 Dcp2 Saccharomyces cerevisiae Ampicillin PMID:32553117 Impaired Edc3 binding site (first HLM). 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Lysine at position 255 is mutated to Alanine 2026-08-15 01:09:13 0
Dcp2 300 AAAA
 
Resource Report
Resource Website 		RRID:Addgene_163579 Dcp2 Saccharomyces cerevisiae Ampicillin PMID:32553117 impaired RNA binding. 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Truncation of C-terminal domain (301-970); mutations: R170A K212A K216A R229A 2026-08-15 01:09:13 0
Dcp2 300 ΔH1
 
Resource Report
Resource Website 		RRID:Addgene_163578 Dcp2 Saccharomyces cerevisiae Ampicillin PMID:32553117 Lacking C-terminal domain, impaired Edc3 binding site (first HLM). 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Truncation of C-terminal domain (301-970); Lysine at position 255 is mutated to Alanine 2026-08-15 01:09:13 0
pDownstream1Lox
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_164574 Green fluorescent protein - human dihydrofolate reductase (GFP-2A-hDHFR) Saccharomyces cerevisiae Ampicillin Vector Backbone:pBluescript; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-15 01:09:22 2
pCL10
 
Resource Report
Resource Website 		RRID:Addgene_164710 MET3pr - yEVenus - CLN2 PEST - ADH1t Saccharomyces cerevisiae Ampicillin PMID:37369667 yEVenus is a codon-optimized yEGFP variant with F46L, S65G, V68L, S72A, M153T, V163A, S175G, and T203Y mutations. Please visit https://www.biorxiv.org/content/10.1101/2020.08.16.253310v2 for bioRxiv preprint. Vector Backbone:pRS406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:09:23 0
pVG50
 
Resource Report
Resource Website 		RRID:Addgene_164708 ADH1t - tetOpr - yEVenus - CLN2 PEST - ADH1t Saccharomyces cerevisiae Ampicillin PMID:37369667 yEVenus is a codon-optimized yEGFP variant with F46L, S65G, V68L, S72A, M153T, V163A, S175G, and T203Y mutations. Please visit https://www.biorxiv.org/content/10.1101/2020.08.16.253310v2 for bioRxiv preprint. Vector Backbone:pRS406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:09:23 0
pVG48
 
Resource Report
Resource Website 		RRID:Addgene_164706 PGK1pr - rtTA - CYC1t Saccharomyces cerevisiae Ampicillin PMID:37369667 yEVenus is a codon-optimized yEGFP variant with F46L, S65G, V68L, S72A, M153T, V163A, S175G, and T203Y mutations. Please visit https://www.biorxiv.org/content/10.1101/2020.08.16.253310v2 for bioRxiv preprint. Backbone Marker:Zhou et al, Nature, 2018 PMID: 29562237; Vector Backbone:EZL105; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:09:23 0
pVG46
 
Resource Report
Resource Website 		RRID:Addgene_164704 PHO5pr - yEVenus - CLN2 PEST - ADH1t Saccharomyces cerevisiae Ampicillin PMID:37369667 yEVenus is a codon-optimized yEGFP variant with F46L, S65G, V68L, S72A, M153T, V163A, S175G, and T203Y mutations. Please visit https://www.biorxiv.org/content/10.1101/2020.08.16.253310v2 for bioRxiv preprint. Vector Backbone:pRS406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:09:23 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch