Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Erk5
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11046135
Proper citation: RRID:Addgene_31817 Copy
Species: Mus musculus
Genetic Insert: Mutant MEF2-dependent promoter (-307 to -242 of Nur77/NR4A1)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5600; Vector Backbone:pGL2-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7565789
Comments: The minimal c-fos promoter fragment was cloned into the SmaI and BglII sites of pGL2 basic. The mutated RSRF sequence (two CTATATTTAG RSRF sites mutated to CGATATTTCG) of the -307 to -242 Nur77/NR4A1 promoter region was cloned in to the SalI site of this SmaI/BglII fragment.
Proper citation: RRID:Addgene_31819 Copy
Species: Mus musculus
Genetic Insert: miR-9/9* and miR-124
Vector Backbone Description: Backbone Marker:Open Biosystems; Backbone Size:11315; Vector Backbone:pLemir; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21753754
Proper citation: RRID:Addgene_31779 Copy
Species: Mus musculus
Genetic Insert: ULK1
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19225151
Proper citation: RRID:Addgene_31962 Copy
Species: Mus musculus
Genetic Insert: Metallothionein
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6700; Vector Backbone:pMAL-c2x; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17692533
Comments: The metallothionein (MT) gene was amplified with the forward primer (5'-CTCGGGATCGAGGGAAGGATTTCAAGA TATACCATGGACCCC-3'), which codes for the MBP linker region containing an XmnI and NcoI site fused in frame to the MT gene, and the reverse primer (5'-GACT CTAGAGGATCCTAGGCACAGCACGTG-3' ), which contains the MT gene stop codon and a subsequent BamHI site. Both the PCR product and pMAL-c2x vector were digested with XmnI and BamHI and were later ligated together to generate the final plasmid. In addition to this plasmid Addgene offers versions with 2 copies (32102), 3 copies (32115) and 4 copies (32100) of MT
Proper citation: RRID:Addgene_32101 Copy
Species: Mus musculus
Genetic Insert: shRNA against mouse HDAC5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2854; Vector Backbone:pENTR/U6; Vector Types:RNAi, Gateway U6 ENTRY Vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21565617
Proper citation: RRID:Addgene_32222 Copy
Species: Mus musculus
Genetic Insert: shRNA targetting Hmga2
Vector Backbone Description: Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21471965
Proper citation: RRID:Addgene_32399 Copy
Species: Mus musculus
Genetic Insert: Rb promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20100864
Proper citation: RRID:Addgene_32390 Copy
Species: Mus musculus
Genetic Insert: p107 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20100864
Proper citation: RRID:Addgene_32392 Copy
Species: Mus musculus
Genetic Insert: Mdm2 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15090541
Proper citation: RRID:Addgene_32373 Copy
Species: Mus musculus
Genetic Insert: Mdm2 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15090541
Proper citation: RRID:Addgene_32370 Copy
Species: Mus musculus
Genetic Insert: Mdm2 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15090541
Proper citation: RRID:Addgene_32365 Copy
Species: Mus musculus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase beta
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21669867
Comments: A W374C mutation is also present in the pEGFP-N1-CaMKKbeta constructs that were used in this publication.
Proper citation: RRID:Addgene_32453 Copy
Species: Mus musculus
Genetic Insert: E1, ubiquitin-activating enzyme
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET-28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22012022
Proper citation: RRID:Addgene_32534 Copy
Species: Mus musculus
Genetic Insert: GPD1L 3'UTR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555452
Comments: Seed mutant sequence - GTCGACCTCAGTGAATGCGTGTC
Proper citation: RRID:Addgene_32490 Copy
Species: Mus musculus
Genetic Insert: GPD1L
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555452
Proper citation: RRID:Addgene_32486 Copy
Species: Mus musculus
Genetic Insert: GPD1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555452
Proper citation: RRID:Addgene_32487 Copy
Species: Mus musculus
Genetic Insert: Pax7d
Vector Backbone Description: Backbone Marker:Addgene plasmid #32516; Backbone Size:7900; Vector Backbone:pOZ-FH-C-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19458195
Proper citation: RRID:Addgene_32518 Copy
Species: Mus musculus
Genetic Insert: Gal4p65
Vector Backbone Description: Vector Backbone:pXcX; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19298646
Proper citation: RRID:Addgene_32573 Copy
Species: Mus musculus
Genetic Insert: Gal4p65
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19212426
Proper citation: RRID:Addgene_32571 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.