Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: 5xGal4
Vector Backbone Description: Backbone Marker:Brown lab; Vector Backbone:pGL3-E6s; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22966205
Proper citation: RRID:Addgene_46324 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 5xGal4
Vector Backbone Description: Vector Backbone:pCMV-luc; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22966205
Proper citation: RRID:Addgene_46322 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Lifeact
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23870127
Proper citation: RRID:Addgene_46356 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: FUN30, CUE domain mutated
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:8964; Vector Backbone:pYES2.1/V5-His/lacZ; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19956593
Proper citation: RRID:Addgene_46792 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: FUN30
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:8964; Vector Backbone:pYES2.1/V5-His/lacZ; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19956593
Proper citation: RRID:Addgene_46790 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: FUN30 without CUE domain
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:8964; Vector Backbone:pYES2.1/V5-His/lacZ; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19956593
Proper citation: RRID:Addgene_46791 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: FUN30
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:8964; Vector Backbone:pYES2.1/V5-His/lacZ; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19956593
Proper citation: RRID:Addgene_46789 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: sgTEF1 promoter
Vector Backbone Description: Backbone Size:5083; Vector Backbone:AH057; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981
Comments: gRNA target sequence TTGATATTTAAGTTAATAAA
Proper citation: RRID:Addgene_46922 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Codon-optimized sequences for MEV pathway expression in E. coli to produce limonene
Vector Backbone Description: Backbone Size:3500; Vector Backbone:pBbA5c; Vector Types:Bacterial Expression, Synthetic Biology, BglBrick; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:23727191
Comments: The R364S mutation in the MK is not known to alter the function. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_47048 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: URA3
Vector Backbone Description: Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pPCR-Script Amp SK(+); Vector Types:PCR template; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24639370
Comments: Primer sequences (5' to 3'): U2, CGTACGCTGCAGGTCGAC; D2, ATCGATGAATTCGAGCTCG.
Proper citation: RRID:Addgene_47554 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: CAN1.y gRNA
Vector Backbone Description: Backbone Size:5886; Vector Backbone:p426; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23460208
Comments: gRNA target sequence GATACGTTCTCTATGGAGGA
Proper citation: RRID:Addgene_43803 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Atg17
Vector Backbone Description: Backbone Size:2800; Vector Backbone:pST39; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23219485
Proper citation: RRID:Addgene_44174 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Vps27-UIM2 (290-330)
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGST-parallel.1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20150893
Proper citation: RRID:Addgene_44427 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Vps27-UIM1
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGST-parallel.1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20150893
Proper citation: RRID:Addgene_44426 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yVps27 tandem UIM (245-330)
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGST-parallel.1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20150893
Proper citation: RRID:Addgene_44428 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yGGA1-VHS
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGST1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20150893
Proper citation: RRID:Addgene_44421 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yGGA2 (1-169)
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGST1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20150893
Proper citation: RRID:Addgene_44422 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hse1-VHS
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGST2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20150893
Proper citation: RRID:Addgene_44415 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Histone 4 N-terminus aa1-34
Vector Backbone Description: Vector Backbone:pGEX2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7867066
Proper citation: RRID:Addgene_44517 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Histone 4
Vector Backbone Description: Vector Backbone:pGEX2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7867066
Proper citation: RRID:Addgene_44518 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
