Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 153 showing 3041 ~ 3060 out of 12,959 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_84321

http://www.addgene.org/84321

Species: Mus musculus
Genetic Insert: Pou2f3
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3015; Vector Backbone:pGEM-T easy; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27243442
Comments: NcoI digestion and SP6 RNA polymerase for antisense probe

Proper citation: RRID:Addgene_84321 Copy   


  • RRID:Addgene_8440

http://www.addgene.org/8440

Species: Mus musculus
Genetic Insert: SIRT1
Vector Backbone Description: Backbone Size:9220; Vector Backbone:pAd-Track-CMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15744310

Proper citation: RRID:Addgene_8440 Copy   


  • RRID:Addgene_8439

    This resource has 1+ mentions.

http://www.addgene.org/8439

Species: Mus musculus
Genetic Insert: SIRT1
Vector Backbone Description: Backbone Size:9220; Vector Backbone:pAd-Track-CMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15744310

Proper citation: RRID:Addgene_8439 Copy   


http://www.addgene.org/8448

Species: Mus musculus
Genetic Insert: Mouse c-myc (exons II and III)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pSP64; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8455630

Proper citation: RRID:Addgene_8448 Copy   


  • RRID:Addgene_84568

http://www.addgene.org/84568

Species: Mus musculus
Genetic Insert: Srap1
Vector Backbone Description: Backbone Marker:Millipore; Backbone Size:5400; Vector Backbone:pET30a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29020633

Proper citation: RRID:Addgene_84568 Copy   


http://www.addgene.org/84561

Species: Mus musculus
Genetic Insert: FLAG tag, Suntag, oxBFP, Auxin-inducible degron, beta-actin 3'UTR, MS2V5 stem-loops
Vector Backbone Description: Backbone Size:6255; Vector Backbone:pUbC lentivirus expression vector (2nd generation); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27313041

Proper citation: RRID:Addgene_84561 Copy   


  • RRID:Addgene_8461

http://www.addgene.org/8461

Species: Mus musculus
Genetic Insert: FBP30?
Vector Backbone Description: Backbone Size:0; Vector Backbone:na; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10744724
Comments: (Leder #C-1093)

Proper citation: RRID:Addgene_8461 Copy   


  • RRID:Addgene_8457

http://www.addgene.org/8457

Species: Mus musculus
Genetic Insert: siTwist
Vector Backbone Description: Backbone Size:9439; Vector Backbone:pSP-108; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15210113
Comments: Twist-siRNA7-targetting sequence is AGCGGGTCATGGCTAACGTGC

Proper citation: RRID:Addgene_8457 Copy   


  • RRID:Addgene_8456

http://www.addgene.org/8456

Species: Mus musculus
Genetic Insert: siTwist
Vector Backbone Description: Backbone Size:9439; Vector Backbone:pSP-108; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15210113
Comments: Twist-siRNA5-targetting sequence is AGGTACATCGACTTCCTGTAC

Proper citation: RRID:Addgene_8456 Copy   


http://www.addgene.org/8494

Species: Mus musculus
Genetic Insert: HOXA9
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9343407
Comments: See author's map.

Proper citation: RRID:Addgene_8494 Copy   


http://www.addgene.org/8493

Species: Mus musculus
Genetic Insert: HoxA9
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9343407
Comments: Deborah Wolgemuth

Proper citation: RRID:Addgene_8493 Copy   


  • RRID:Addgene_84883

http://www.addgene.org/84883

Species: Mus musculus
Genetic Insert: Multicloning sites and selection cassette
Vector Backbone Description: Backbone Marker:agilent; Backbone Size:4650; Vector Backbone:pAAV-MCS; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27264994
Comments: Sequencing over ITR sequences may be difficult. We used additional internal sequencing primers

Proper citation: RRID:Addgene_84883 Copy   


http://www.addgene.org/8803

Species: Mus musculus
Genetic Insert: Bad
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11493700

Proper citation: RRID:Addgene_8803 Copy   


  • RRID:Addgene_8807

http://www.addgene.org/8807

Species: Mus musculus
Genetic Insert: Bid p22
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9873064

Proper citation: RRID:Addgene_8807 Copy   


  • RRID:Addgene_8806

http://www.addgene.org/8806

Species: Mus musculus
Genetic Insert: Bax
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pMIG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12881569

Proper citation: RRID:Addgene_8806 Copy   


http://www.addgene.org/8805

Species: Mus musculus
Genetic Insert: Bim genomic
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2462; Vector Backbone:pSP72; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15486085

Proper citation: RRID:Addgene_8805 Copy   


  • RRID:Addgene_87952

http://www.addgene.org/87952

Species: Mus musculus
Genetic Insert: Tumor Suppressor Candidate 5
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26240143

Proper citation: RRID:Addgene_87952 Copy   


  • RRID:Addgene_8813

http://www.addgene.org/8813

Species: Mus musculus
Genetic Insert: GABPb1 (1-157)
Vector Backbone Description: Backbone Size:3350; Vector Backbone:pG5'; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9461436

Proper citation: RRID:Addgene_8813 Copy   


http://www.addgene.org/8810

Species: Mus musculus
Genetic Insert: Bax alpha
Vector Backbone Description: Backbone Size:7200; Vector Backbone:pSFFV-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7569956

Proper citation: RRID:Addgene_8810 Copy   


http://www.addgene.org/8795

Species: Mus musculus
Genetic Insert: Bad
Vector Backbone Description: Backbone Size:7200; Vector Backbone:pSFFV-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9305851

Proper citation: RRID:Addgene_8795 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X