Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 153 showing 3041 ~ 3060 out of 69,553 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/178871

Species: Homo sapiens
Genetic Insert: PB1-AzamiGreen-FRB-TEVcs(ENLYFQL)-mTagBFP2-HA-SOS1(Rem-Cdc25)
Vector Backbone Description: Backbone Marker:MBL International; Backbone Size:4244; Vector Backbone:pAsh-MCL; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33890764

Proper citation: RRID:Addgene_178871 Copy   


  • RRID:Addgene_178885

    This resource has 1+ mentions.

http://www.addgene.org/178885

Species: Homo sapiens
Genetic Insert: human rhinovirus 3C protease
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_178885 Copy   


  • RRID:Addgene_178831

http://www.addgene.org/178831

Species: Homo sapiens
Genetic Insert: artificial gene encoding human Saposin A
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_178831 Copy   


  • RRID:Addgene_17877

    This resource has 1+ mentions.

http://www.addgene.org/17877

Species: Homo sapiens
Genetic Insert: BAF57
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12110891
Comments: Full-length human BAF57.

Proper citation: RRID:Addgene_17877 Copy   


  • RRID:Addgene_17879

    This resource has 1+ mentions.

http://www.addgene.org/17879

Species: Homo sapiens
Genetic Insert: BAF53a
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9845365
Comments: Full-length human BAF53a.

Proper citation: RRID:Addgene_17879 Copy   


  • RRID:Addgene_1788

    This resource has 10+ mentions.

http://www.addgene.org/1788

Species: Homo sapiens
Genetic Insert: FOXO3a
Vector Backbone Description: Backbone Size:2933; Vector Backbone:pECE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10102273
Comments: See HA-FOXO3a WT for wild-type sequence and map.

Proper citation: RRID:Addgene_1788 Copy   


  • RRID:Addgene_1789

    This resource has 10+ mentions.

http://www.addgene.org/1789

Species: Homo sapiens
Genetic Insert: FHRE
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5000; Vector Backbone:pGL3 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10102273
Comments: See author's map and sequence.

Proper citation: RRID:Addgene_1789 Copy   


  • RRID:Addgene_179162

http://www.addgene.org/179162

Species: Homo sapiens
Genetic Insert: protein phosphatase 3, catalytic subunit, gamma isoform
Vector Backbone Description: Backbone Size:5175; Vector Backbone:pCAG1.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26429887

Proper citation: RRID:Addgene_179162 Copy   


  • RRID:Addgene_179163

http://www.addgene.org/179163

Species: Homo sapiens
Genetic Insert: protein phosphatase 3, regulatory subunit B, beta isoform
Vector Backbone Description: Backbone Size:5142; Vector Backbone:pCAG1.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26429887

Proper citation: RRID:Addgene_179163 Copy   


http://www.addgene.org/179225

Species: Homo sapiens
Genetic Insert: DDX21
Vector Backbone Description: Vector Backbone:pHAGE-EF1a-IRES-ZsGreen; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34326237

Proper citation: RRID:Addgene_179225 Copy   


http://www.addgene.org/179226

Species: Homo sapiens
Genetic Insert: DDX21
Vector Backbone Description: Vector Backbone:pHAGE-EF1a-IRES-ZsGreen; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34326237

Proper citation: RRID:Addgene_179226 Copy   


http://www.addgene.org/179227

Species: Homo sapiens
Genetic Insert: DDX21
Vector Backbone Description: Vector Backbone:pHAGE-EF1a-IRES-ZsGreen; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34326237

Proper citation: RRID:Addgene_179227 Copy   


  • RRID:Addgene_178950

    This resource has 1+ mentions.

http://www.addgene.org/178950

Species: Homo sapiens
Genetic Insert: APOBEC1-YTHmut-T2A-GFP
Vector Backbone Description: Backbone Marker:Adam Karpf (Feng Zhang); Backbone Size:11775; Vector Backbone:TLCV2 (lentiCRISPR v2); Vector Types:Mammalian Expression, Lentiviral, Synthetic Biology, Inducible; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35081365

Proper citation: RRID:Addgene_178950 Copy   


  • RRID:Addgene_178949

    This resource has 1+ mentions.

http://www.addgene.org/178949

Species: Homo sapiens
Genetic Insert: APOBEC1-YTH-T2A-GFP
Vector Backbone Description: Backbone Marker:Feng Zhang lab; Backbone Size:11777; Vector Backbone:lentiCRISPR v2; Vector Types:Mammalian Expression, Lentiviral, Synthetic Biology, Inducible; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35081365

Proper citation: RRID:Addgene_178949 Copy   


  • RRID:Addgene_179141

http://www.addgene.org/179141

Species: Homo sapiens
Genetic Insert: Src, SsrA
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34637702

Proper citation: RRID:Addgene_179141 Copy   


  • RRID:Addgene_1790

    This resource has 1+ mentions.

http://www.addgene.org/1790

Species: Homo sapiens
Genetic Insert: FOXO3a
Vector Backbone Description: Backbone Size:4968; Vector Backbone:pGex 4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10102273
Comments: See author's sequence and map.

Proper citation: RRID:Addgene_1790 Copy   


  • RRID:Addgene_179136

http://www.addgene.org/179136

Species: Homo sapiens
Genetic Insert: protein phosphatase 3, regulatory subunit B, alpha isoform
Vector Backbone Description: Backbone Size:5142; Vector Backbone:pCAG1.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34446558

Proper citation: RRID:Addgene_179136 Copy   


  • RRID:Addgene_17921

http://www.addgene.org/17921

Species: Homo sapiens
Genetic Insert: shFEN
Vector Backbone Description: Backbone Size:7200; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18394896
Comments: Target sequence: TCACTAAGCAGCACAATGAT

Proper citation: RRID:Addgene_17921 Copy   


  • RRID:Addgene_179328

http://www.addgene.org/179328

Species: Homo sapiens
Genetic Insert: WWP1 F792D
Vector Backbone Description: Backbone Marker:GEHealthcare; Vector Backbone:pGEX4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Best yields for protein purification were found in BL21 (DE) cells using an overnight induction at 16C

Proper citation: RRID:Addgene_179328 Copy   


http://www.addgene.org/179440

Species: Homo sapiens
Genetic Insert: H2B-mIFP-T2A-rTetR-HDAC4
Vector Backbone Description: Vector Backbone:pPB (PiggyBac); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35678392
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.11.04.467237v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_179440 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X