Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:saccharomyces cerevisiae (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

4,486 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
p414CYC_Hsp82_noTER
 
Resource Report
Resource Website 		RRID:Addgene_61716 6xHis-Hsp82 Saccharomyces cerevisiae Ampicillin PMID:23825969 Vector Backbone:p414; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:45 0
RPS1B-GFP (95)
 
Resource Report
Resource Website 		RRID:Addgene_24039 RPS1B Saccharomyces cerevisiae Ampicillin Entire RPS1B ORF inserted upstream of eGFP in EcoRI/HindIII of yEGFP3. Two missense mutations, D203V and K214E, detected in Addgene quality control. There is no evidence to suggest mutations affect activity. Backbone Size:5000; Vector Backbone:yEGFP3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:28 0
RPL25NLS-GFP (101)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24038 RPL25 Saccharomyces cerevisiae Ampicillin NLS of RPL25 (bp 1-135) fused upstream of eGFP in EcoRI/SalI of pYX242 Backbone Size:5000; Vector Backbone:pYX242; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Only bp 1-135 (aa 1-45) of RPL25 2026-08-15 01:12:27 1
pTOPO-rDNA-NTS
 
Resource Report
Resource Website 		RRID:Addgene_23992 rDNA NTS Saccharomyces cerevisiae Ampicillin and Kanamycin PMID:15489292 Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pTOPO; Vector Types:Bacterial Cloning - TOPO; Bacterial Resistance:Ampicillin and Kanamycin None 2026-08-15 01:12:26 0
KAP121-FLU (115)
 
Resource Report
Resource Website 		RRID:Addgene_24047 KAP121 Saccharomyces cerevisiae Ampicillin KAP121 fused upstream of two FLU tags in BamHI/SalI of pBT024 Backbone Marker:Rosemary Williams (Rout Lab); Backbone Size:7100; Vector Backbone:pYEX-U (modified pYEX-BX); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:28 0
RPL3-GFP (96)
 
Resource Report
Resource Website 		RRID:Addgene_24040 RPL3 Saccharomyces cerevisiae Ampicillin Entire RPL3 ORF inserted upstream of eGFP in EcoRI/HindIII of yEGFP3. An F379S mutation found in Addgene quality control sequencing. No evidence to suggest mutation affects activity. Backbone Size:5000; Vector Backbone:yEGFP3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:27 0
RPL25NLS-GFP-PRA (102)
 
Resource Report
Resource Website 		RRID:Addgene_24041 RPL25 Saccharomyces cerevisiae Ampicillin NLS of RPL25 (bp 1-135) fused upstream of eGFP in EcoRI/HindIII of pYX242 followed by a single PrA repeat in HindIII/SalI. PrA motif sequence downstream of GFP: GCTCAACAAAATGCTTTTTATCAAGTCTTAAATATGCCTAACTTAAATGCTGATCAACGCAATGGTTTTATCCAAAGCCTTAAAGATGATCCAAGCCAAAGTGCTAACGTTTTAGGTGAAGCTCAAAAACTTAATGACTCTCAAGCTCCAAAAGCTGATGCGCAACAAAATAAC Backbone Size:5000; Vector Backbone:pYX242; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Only bp 1-135 (aa 1-45) of RPL25 2026-08-15 01:12:27 0
pGADT7-ADH700-yeCherry-p150-yeGFP-DHFR
 
Resource Report
Resource Website 		RRID:Addgene_24378 pADH1 yeCherry::p150yeGFP-DHFR Saccharomyces cerevisiae Ampicillin PMID:20017217 Backbone Size:6000; Vector Backbone:pGADT7; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 1. Truncated version of ADH700 promoter (SbfI/SpeI) driven yeast enhanced RFP (SpeI/-). 2. p150 IRES (SacII/BglII) driven yeast enhanced GFP fused to E.coli DHFR (BglII/XhoI) 2026-08-15 01:12:31 0
pCMV-GAL80
 
Resource Report
Resource Website 		RRID:Addgene_24347 GAL80 Saccharomyces cerevisiae Ampicillin PMID:20434990 GAL80 cDNA was PCR amplified using primers PR511 (CCCCGGATCCCAACatggactacaacaagagatcttcgg) and PR512 (CGGTTAACGCGGCCGCttataaactataatgcgagatattgctaacg), and a lab vector, pCA-GAL80 as the template. The PCR product was cloned using BamHI and NotI into pCDNA3.1-myc- His-A. A stop codon precedes the Myc and His tags. Backbone Marker:Invitrogen; Backbone Size:5493; Vector Backbone:pcDNA3.1-Myc-His-A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:30 0
pGADT7-ADH700-yeCherry-YAP1-yeGFP-DHFR
 
Resource Report
Resource Website 		RRID:Addgene_24549 pADH1 yeCherry::YAP1 yeGFP-DHFR Saccharomyces cerevisiae Ampicillin PMID:20017217 Backbone Size:6000; Vector Backbone:pGADT7; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 1. Truncated version of ADH700 promoter (SbfI/SpeI) driven yeast enhanced RFP (SpeI/-). 2. YAP1 IRES (SacII/BglII) driven yeast enhanced GFP fused to E.coli DHFR (BglII/XhoI) 2026-08-15 01:12:32 0
pFLAG UBR1 SBX
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24506 UBR1 Saccharomyces cerevisiae Ampicillin PMID:18566452 SBX stands for SalI, BamHI, XhoI. SalI is 15 bp before ATG codon of UBR1ORF. BamHI and XhoI are right after the stop codon of the UBR1ORF. The plasmid expresses UBR1 which is N-terminally Flag tagged and has "clean" C-terminus. Note that it does not have NcoI site upstream of ATG codon. Active in degrading N-end rule substrates. Backbone Size:5741; Vector Backbone:Yeplac 181; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:33 2
MBP-His6-TEV-MMS2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25465 MMS2 Saccharomyces cerevisiae Ampicillin PMID:16980971 Backbone Marker:modified from NEB vector; Backbone Size:0; Vector Backbone:pMalC2XHV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:41 1
YIPlac204-TC-Sec7-6xDsRed-M1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25448 Sec7 Saccharomyces cerevisiae Ampicillin PMID:16699524 Backbone Size:8300; Vector Backbone:YIPlac204; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:41 2
pSSec7-mGFPx3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25449 Sec7 Saccharomyces cerevisiae Ampicillin PMID:16699524 Backbone Size:7700; Vector Backbone:N/A; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin GFP contains A206K for monomerization. 2026-08-15 01:12:43 1
pJL1
 
Resource Report
Resource Website 		RRID:Addgene_174070 pGal-Olac-3xNLS-VP16-CIB1-tADH1 Saccharomyces cerevisiae Ampicillin PMID:34469745 Please visit https://www.biorxiv.org/content/10.1101/2021.01.05.425451v1 for bioRxiv preprint. Vector Backbone:unknown; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:10:37 0
p404GAL1
 
Resource Report
Resource Website 		RRID:Addgene_17417 GAL1 promoter + polylinker + CYC1 terminator Saccharomyces cerevisiae Ampicillin Mumberg D, Muller R, Funk M. Nucleic Acids Res. 25:5767-8 (1994). Backbone Size:2581; Vector Backbone:p404ADH1; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin GAL1 promoter is between SacI and XbaI restriction sites. 2026-08-15 01:10:38 0
pJL45
 
Resource Report
Resource Website 		RRID:Addgene_174067 pGal1-LacO-3NLS-CIB1-tADH1 Saccharomyces cerevisiae Ampicillin PMID:34469745 Please visit https://www.biorxiv.org/content/10.1101/2021.01.05.425451v1 for bioRxiv preprint. Please note: Plasmid contains a 217bp insertion in the backbone downstream of the Tadh1 terminator. This insertion does not affect plasmid function. Vector Backbone:unknown; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:10:37 0
pJL15
 
Resource Report
Resource Website 		RRID:Addgene_174069 pGAL-tetO-3xNLS-43-8WT-GS-Cry2-Tadh1 Saccharomyces cerevisiae Ampicillin PMID:34469745 Please visit https://www.biorxiv.org/content/10.1101/2021.01.05.425451v1 for bioRxiv preprint. Vector Backbone:unknown; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:10:37 0
p406GALL
 
Resource Report
Resource Website 		RRID:Addgene_17434 GALL promoter + polylinker + CYC1 terminator Saccharomyces cerevisiae Ampicillin Mumberg D, Muller R, Funk M. Nucleic Acids Res. 25:5767-8 (1994). Backbone Size:2691; Vector Backbone:p406ADH1; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin GALL promoter is between SacI and XbaI restriction sites. 2026-08-15 01:10:39 0
p404GALS
 
Resource Report
Resource Website 		RRID:Addgene_17435 GALS promoter + polylinker + CYC1 terminator Saccharomyces cerevisiae Ampicillin Mumberg D, Muller R, Funk M. Nucleic Acids Res. 25:5767-8 (1994). Backbone Marker:Sikorski & Hieter, Genetics 122:19-27 (1989); Backbone Size:2581; Vector Backbone:pRS404; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin GALS promoter is between SacI and XbaI restriction sites. 2026-08-15 01:10:39 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch