Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: 6xHis-Hsp82
Vector Backbone Description: Vector Backbone:p414; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23825969
Proper citation: RRID:Addgene_61716 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RPS1B
Vector Backbone Description: Backbone Size:5000; Vector Backbone:yEGFP3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: Entire RPS1B ORF inserted upstream of eGFP in EcoRI/HindIII of yEGFP3. Two missense mutations, D203V and K214E, detected in Addgene quality control. There is no evidence to suggest mutations affect activity.
Proper citation: RRID:Addgene_24039 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RPL25
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pYX242; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: NLS of RPL25 (bp 1-135) fused upstream of eGFP in EcoRI/SalI of pYX242
Proper citation: RRID:Addgene_24038 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: rDNA NTS
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pTOPO; Vector Types:Bacterial Cloning - TOPO; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:15489292
Proper citation: RRID:Addgene_23992 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: KAP121
Vector Backbone Description: Backbone Marker:Rosemary Williams (Rout Lab); Backbone Size:7100; Vector Backbone:pYEX-U (modified pYEX-BX); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: KAP121 fused upstream of two FLU tags in BamHI/SalI of pBT024
Proper citation: RRID:Addgene_24047 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RPL3
Vector Backbone Description: Backbone Size:5000; Vector Backbone:yEGFP3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: Entire RPL3 ORF inserted upstream of eGFP in EcoRI/HindIII of yEGFP3.
An F379S mutation found in Addgene quality control sequencing. No evidence to suggest mutation affects activity.
Proper citation: RRID:Addgene_24040 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RPL25
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pYX242; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: NLS of RPL25 (bp 1-135) fused upstream of eGFP in EcoRI/HindIII of pYX242 followed by a single PrA repeat in HindIII/SalI.
PrA motif sequence downstream of GFP:
GCTCAACAAAATGCTTTTTATCAAGTCTTAAATATGCCTAACTTAAATGCTGATCAACGCAATGGTTTTATCCAAAGCCTTAAAGATGATCCAAGCCAAAGTGCTAACGTTTTAGGTGAAGCTCAAAAACTTAATGACTCTCAAGCTCCAAAAGCTGATGCGCAACAAAATAAC
Proper citation: RRID:Addgene_24041 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: pADH1 yeCherry::p150yeGFP-DHFR
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pGADT7; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20017217
Proper citation: RRID:Addgene_24378 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GAL80
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5493; Vector Backbone:pcDNA3.1-Myc-His-A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20434990
Comments: GAL80 cDNA was PCR amplified using primers PR511
(CCCCGGATCCCAACatggactacaacaagagatcttcgg) and PR512
(CGGTTAACGCGGCCGCttataaactataatgcgagatattgctaacg), and a lab vector, pCA-GAL80 as the
template. The PCR product was cloned using BamHI and NotI into pCDNA3.1-myc-
His-A.
A stop codon precedes the Myc and His tags.
Proper citation: RRID:Addgene_24347 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: pADH1 yeCherry::YAP1 yeGFP-DHFR
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pGADT7; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20017217
Proper citation: RRID:Addgene_24549 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: UBR1
Vector Backbone Description: Backbone Size:5741; Vector Backbone:Yeplac 181; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18566452
Comments: SBX stands for SalI, BamHI, XhoI. SalI is 15 bp before ATG codon of UBR1ORF. BamHI and XhoI are right after the stop codon of the UBR1ORF.
The plasmid expresses UBR1 which is N-terminally Flag tagged and has "clean" C-terminus.
Note that it does not have NcoI site upstream of ATG codon. Active in degrading N-end rule substrates.
Proper citation: RRID:Addgene_24506 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: MMS2
Vector Backbone Description: Backbone Marker:modified from NEB vector; Backbone Size:0; Vector Backbone:pMalC2XHV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16980971
Proper citation: RRID:Addgene_25465 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Sec7
Vector Backbone Description: Backbone Size:8300; Vector Backbone:YIPlac204; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16699524
Proper citation: RRID:Addgene_25448 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Sec7
Vector Backbone Description: Backbone Size:7700; Vector Backbone:N/A; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16699524
Proper citation: RRID:Addgene_25449 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: pGal-Olac-3xNLS-VP16-CIB1-tADH1
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34469745
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.01.05.425451v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_174070 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GAL1 promoter + polylinker + CYC1 terminator
Vector Backbone Description: Backbone Size:2581; Vector Backbone:p404ADH1; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Comments: Mumberg D, Muller R, Funk M. Nucleic Acids Res. 25:5767-8 (1994).
Proper citation: RRID:Addgene_17417 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: pGal1-LacO-3NLS-CIB1-tADH1
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34469745
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.01.05.425451v1 for bioRxiv preprint.
Please note: Plasmid contains a 217bp insertion in the backbone downstream of the Tadh1 terminator. This insertion does not affect plasmid function.
Proper citation: RRID:Addgene_174067 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: pGAL-tetO-3xNLS-43-8WT-GS-Cry2-Tadh1
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34469745
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.01.05.425451v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_174069 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GALL promoter + polylinker + CYC1 terminator
Vector Backbone Description: Backbone Size:2691; Vector Backbone:p406ADH1; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Comments: Mumberg D, Muller R, Funk M. Nucleic Acids Res. 25:5767-8 (1994).
Proper citation: RRID:Addgene_17434 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GALS promoter + polylinker + CYC1 terminator
Vector Backbone Description: Backbone Marker:Sikorski & Hieter, Genetics 122:19-27 (1989); Backbone Size:2581; Vector Backbone:pRS404; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Comments: Mumberg D, Muller R, Funk M. Nucleic Acids Res. 25:5767-8 (1994).
Proper citation: RRID:Addgene_17435 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
