Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: FCER1G
Vector Backbone Description: Backbone Marker:Mark M Davis; Backbone Size:6600; Vector Backbone:pBJ1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2138619
Comments: This construct contains only the coding sequence. It was first used in Lin S, Cicala C, Scharenberg AM, Kinet J-P (1996) Cell 85, 985-995. It can be sequenced with primers within the insert.
Proper citation: RRID:Addgene_16540 Copy
Species: Homo sapiens
Genetic Insert: UbeE1L
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4900; Vector Backbone:pGEX4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Best yields for protein purification were found in BL21 (DE) cells using an overnight induction at 16 degrees C.
Proper citation: RRID:Addgene_165099 Copy
Species: Homo sapiens
Genetic Insert: ShadowY-RBD-P2A-Clover(T153M/F223R)-RhoA
Vector Backbone Description: Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33531495
Proper citation: RRID:Addgene_165435 Copy
Species: Homo sapiens
Genetic Insert: ShadowY-CBD-P2A-Clover(T153M/F223R)-Cdc42
Vector Backbone Description: Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33531495
Proper citation: RRID:Addgene_165434 Copy
Species: Homo sapiens
Genetic Insert: Heterochromatin protein 1 binding protein 3
Vector Backbone Description: Backbone Marker:Stratagene /Agilent; Backbone Size:5200; Vector Backbone:pCMV-3Tag-8 modified MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24778252
Comments: Backbone contains new multiple cloning site and c-terminal HA epitope instead of FLAGs. Construction: XhoI-ACC-[HP1BP3 CDS 1650 bp, no stop]-Noti-a-Clai-HA epitope tag-ctt-STOP. T3 forward primer is too close for sequencing of initiation sequence.
Proper citation: RRID:Addgene_165468 Copy
Species: Homo sapiens
Genetic Insert: TANGO1S
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pIRES_neo3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34350936
Proper citation: RRID:Addgene_165461 Copy
Species: Homo sapiens
Genetic Insert: ZEB2
Vector Backbone Description: Backbone Size:11520; Vector Backbone:AAVS1-Puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33765444
Proper citation: RRID:Addgene_165456 Copy
Species: Homo sapiens
Genetic Insert: Membrane bound O-acyltransferase domain containing 7
Vector Backbone Description: Backbone Marker:Stratagene /Agilent; Backbone Size:5200; Vector Backbone:pCMV-3Tag-8 modified MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21903422
Comments: Backbone contains new MCS (multiple cloning site). CDS without stop codon was inserted with XhoI-NotI and it expresses in frame with 3xFLAG epitope tag. Construct insertion = Xhoi-GCC-[MBOAT7 CDS 1416 bp, no stop]-Noti-A-Clai-GTCGAG-3xFLAG-STOP
Proper citation: RRID:Addgene_165474 Copy
Species: Homo sapiens
Genetic Insert: Adenosine deaminase RNA specific B2 (inactive)
Vector Backbone Description: Backbone Marker:Stratagene /Agilent; Backbone Size:5200; Vector Backbone:pCMV-3Tag-8 modified MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24778252
Comments: Backbone contains new MCS (multiple cloning site). MCS is changed to: ctcgagctgaagcttcatggatccaaagcggccgcaatcgat (XhoI-ctg-HindIII-cat-BamHI-aaa-NotI-a-ClaI). CDS without stop codon was inserted into MCS at unkown restriction enzyme sites, and it expresses in frame with 3xFLAG epitope tag. Xhoi was probably the 5' cloning site.
Proper citation: RRID:Addgene_165470 Copy
Species: Homo sapiens
Genetic Insert: PPAR gamma
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10555149
Comments: Note that there are some discrepancies between the insert in this plasmid and the canonical GenBank PPARgamma. The Vogelstein lab maintains that this plasmid worked as specified when they made and used it.
Proper citation: RRID:Addgene_16549 Copy
Species: Homo sapiens
Genetic Insert: gRNA against PGC-1a variant 1
Vector Backbone Description: Backbone Size:9580; Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33626346
Proper citation: RRID:Addgene_165425 Copy
Species: Homo sapiens
Genetic Insert: p73
Vector Backbone Description: Backbone Size:5210; Vector Backbone:pBI-MCS-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10588737
Comments: Tet-responsive p73 expression construct.
Proper citation: RRID:Addgene_16545 Copy
Species: Homo sapiens
Genetic Insert: gRNA against human Total PGC-1a variants
Vector Backbone Description: Backbone Size:9580; Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33626346
Proper citation: RRID:Addgene_165426 Copy
Species: Homo sapiens
Genetic Insert: PPAR alpha
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10555149
Proper citation: RRID:Addgene_16550 Copy
Species: Homo sapiens
Genetic Insert: Human histone H2B
Vector Backbone Description: Backbone Marker:-; Backbone Size:8023; Vector Backbone:pRRL-cPPT-hPGKTMPrtTA-WPRE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29944140
Comments: ABOUT BACKBONE:
The lentiviral backbone was originally designed and constructed by Barde I et al. (Barde I et al. Mol Ther. 2006. 13(2): 382-90. PMID: 16275162).
ABOUT TEST DIGESTION:
Since Xba I restriction site is lost during cloning, we recommend checking the plasmid using the enzymes: Xho I and Nhe I. You should get two fragments around 1600 bp (insert+vector) and 7500 bp (vector).
Proper citation: RRID:Addgene_165494 Copy
Species: Homo sapiens
Genetic Insert: ribosomal protein S6 kinase A5
Vector Backbone Description: Vector Backbone:LentiCRISPR v2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33563994
Proper citation: RRID:Addgene_165601 Copy
Species: Homo sapiens
Genetic Insert: TEM5
Vector Backbone Description: Backbone Marker:Boehringer; Backbone Size:3553; Vector Backbone:pIVEX2.3-MCS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11559528
Proper citation: RRID:Addgene_16561 Copy
Species: Homo sapiens
Genetic Insert: TEM1
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11559528
Proper citation: RRID:Addgene_16560 Copy
Species: Homo sapiens
Genetic Insert: TCF-4 binding sites
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4800; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10749138
Comments: TCF-4 mutant binding sequence - CCTTTGGC
Proper citation: RRID:Addgene_16559 Copy
Species: Homo sapiens
Genetic Insert: MADMYC
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10688915
Comments: MADMYC: the amino
terminal transactivation domain of c-Myc (aa 1-263) was removed and replaced with the amino terminal transcriptional
repression domain (aa 1-38, the Sin3-interaction region) of Mad.
Proper citation: RRID:Addgene_16557 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
