Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pBJ1 neo-hu FceRI gamma Resource Report Resource Website 1+ mentions |
RRID:Addgene_16540 | FCER1G | Homo sapiens | Ampicillin | PMID:2138619 | This construct contains only the coding sequence. It was first used in Lin S, Cicala C, Scharenberg AM, Kinet J-P (1996) Cell 85, 985-995. It can be sequenced with primers within the insert. | Backbone Marker:Mark M Davis; Backbone Size:6600; Vector Backbone:pBJ1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:28 | 1 | |
|
pGEX4T-1-Optimized UBE1L Resource Report Resource Website |
RRID:Addgene_165099 | UbeE1L | Homo sapiens | Ampicillin | Best yields for protein purification were found in BL21 (DE) cells using an overnight induction at 16 degrees C. | Backbone Marker:GE Healthcare; Backbone Size:4900; Vector Backbone:pGEX4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | codon optimized for E. coli expression | 2026-08-15 01:09:27 | 0 | |
|
CMV-ShadowY-Rhotekin(8-89)-P2A-Clover(T153M/F223R)-RhoA Resource Report Resource Website |
RRID:Addgene_165435 | ShadowY-RBD-P2A-Clover(T153M/F223R)-RhoA | Homo sapiens | Ampicillin | PMID:33531495 | Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:29 | 0 | ||
|
CMV-ShadowY-CBD-P2A-Clover(T153M/F223R)-Cdc42 Resource Report Resource Website |
RRID:Addgene_165434 | ShadowY-CBD-P2A-Clover(T153M/F223R)-Cdc42 | Homo sapiens | Ampicillin | PMID:33531495 | Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:29 | 0 | ||
|
pCMV3Tag8li-hHP1BP3-HA Resource Report Resource Website |
RRID:Addgene_165468 | Heterochromatin protein 1 binding protein 3 | Homo sapiens | Ampicillin | PMID:24778252 | Backbone contains new multiple cloning site and c-terminal HA epitope instead of FLAGs. Construction: XhoI-ACC-[HP1BP3 CDS 1650 bp, no stop]-Noti-a-Clai-HA epitope tag-ctt-STOP. T3 forward primer is too close for sequencing of initiation sequence. | Backbone Marker:Stratagene /Agilent; Backbone Size:5200; Vector Backbone:pCMV-3Tag-8 modified MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:29 | 0 | |
|
TANGO1S-mScarlet-i Resource Report Resource Website 1+ mentions |
RRID:Addgene_165461 | TANGO1S | Homo sapiens | Ampicillin | PMID:34350936 | Backbone Marker:Clontech; Vector Backbone:pIRES_neo3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:29 | 1 | ||
|
AAVS1-Puro-CAG-fl-STOP-fl-ZEB2-GFP-Flag-WPRE-poly(A) Resource Report Resource Website |
RRID:Addgene_165456 | ZEB2 | Homo sapiens | Ampicillin | PMID:33765444 | Backbone Size:11520; Vector Backbone:AAVS1-Puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:29 | 0 | ||
|
pCMV3Tag8li-hMBOAT7-3xFLAG Resource Report Resource Website |
RRID:Addgene_165474 | Membrane bound O-acyltransferase domain containing 7 | Homo sapiens | Ampicillin | PMID:21903422 | Backbone contains new MCS (multiple cloning site). CDS without stop codon was inserted with XhoI-NotI and it expresses in frame with 3xFLAG epitope tag. Construct insertion = Xhoi-GCC-[MBOAT7 CDS 1416 bp, no stop]-Noti-A-Clai-GTCGAG-3xFLAG-STOP | Backbone Marker:Stratagene /Agilent; Backbone Size:5200; Vector Backbone:pCMV-3Tag-8 modified MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:29 | 0 | |
|
pCMV3Tag8li-hADARB2-3xFLAG Resource Report Resource Website |
RRID:Addgene_165470 | Adenosine deaminase RNA specific B2 (inactive) | Homo sapiens | Ampicillin | PMID:24778252 | Backbone contains new MCS (multiple cloning site). MCS is changed to: ctcgagctgaagcttcatggatccaaagcggccgcaatcgat (XhoI-ctg-HindIII-cat-BamHI-aaa-NotI-a-ClaI). CDS without stop codon was inserted into MCS at unkown restriction enzyme sites, and it expresses in frame with 3xFLAG epitope tag. Xhoi was probably the 5' cloning site. | Backbone Marker:Stratagene /Agilent; Backbone Size:5200; Vector Backbone:pCMV-3Tag-8 modified MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:29 | 0 | |
|
pGST-PPARgamma Resource Report Resource Website 1+ mentions |
RRID:Addgene_16549 | PPAR gamma | Homo sapiens | Ampicillin | PMID:10555149 | Note that there are some discrepancies between the insert in this plasmid and the canonical GenBank PPARgamma. The Vogelstein lab maintains that this plasmid worked as specified when they made and used it. | Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | N-terminal DNA-binding domain: aa 1-248 | 2026-08-15 01:09:29 | 2 |
|
pSico_U6-PGC1a1 sgRNA Resource Report Resource Website |
RRID:Addgene_165425 | gRNA against PGC-1a variant 1 | Homo sapiens | Ampicillin | PMID:33626346 | Backbone Size:9580; Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:28 | 0 | ||
|
pBI-p73 wt/EGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_16545 | p73 | Homo sapiens | Ampicillin | PMID:10588737 | Tet-responsive p73 expression construct. | Backbone Size:5210; Vector Backbone:pBI-MCS-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:29 | 1 | |
|
pSico_U6-Pan-PGC1a sgRNA Resource Report Resource Website |
RRID:Addgene_165426 | gRNA against human Total PGC-1a variants | Homo sapiens | Ampicillin | PMID:33626346 | Backbone Size:9580; Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:28 | 0 | ||
|
pGST-PPARalpha Resource Report Resource Website |
RRID:Addgene_16550 | PPAR alpha | Homo sapiens | Ampicillin | PMID:10555149 | Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | N-terminal DNA-binding domain: aa 1-249 | 2026-08-15 01:09:29 | 0 | |
|
pSIN-TRE-H2BeGFP-rtTA2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_165494 | Human histone H2B | Homo sapiens | Ampicillin | PMID:29944140 | ABOUT BACKBONE: The lentiviral backbone was originally designed and constructed by Barde I et al. (Barde I et al. Mol Ther. 2006. 13(2): 382-90. PMID: 16275162). ABOUT TEST DIGESTION: Since Xba I restriction site is lost during cloning, we recommend checking the plasmid using the enzymes: Xho I and Nhe I. You should get two fragments around 1600 bp (insert+vector) and 7500 bp (vector). | Backbone Marker:-; Backbone Size:8023; Vector Backbone:pRRL-cPPT-hPGKTMPrtTA-WPRE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | - | 2026-08-15 01:09:29 | 1 |
|
dCas9-MSK1 Resource Report Resource Website |
RRID:Addgene_165601 | ribosomal protein S6 kinase A5 | Homo sapiens | Ampicillin | PMID:33563994 | Vector Backbone:LentiCRISPR v2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:31 | 0 | ||
|
pIVEX2.3 TEM-5 Resource Report Resource Website |
RRID:Addgene_16561 | TEM5 | Homo sapiens | Ampicillin | PMID:11559528 | Backbone Marker:Boehringer; Backbone Size:3553; Vector Backbone:pIVEX2.3-MCS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Extracellular region | 2026-08-15 01:09:31 | 0 | |
|
pGEX TEM-1 Resource Report Resource Website |
RRID:Addgene_16560 | TEM1 | Homo sapiens | Ampicillin | PMID:11559528 | Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Extracellular region | 2026-08-15 01:09:30 | 0 | |
|
pGL3-OF (mutant TCF-4 sites) Resource Report Resource Website 10+ mentions |
RRID:Addgene_16559 | TCF-4 binding sites | Homo sapiens | Ampicillin | PMID:10749138 | TCF-4 mutant binding sequence - CCTTTGGC | Backbone Marker:Promega; Backbone Size:4800; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 3 copies of mutant Tcf-4 binding sites | 2026-08-15 01:09:30 | 11 |
|
MadMyc-HA Resource Report Resource Website 1+ mentions |
RRID:Addgene_16557 | MADMYC | Homo sapiens | Ampicillin | PMID:10688915 | MADMYC: the amino terminal transactivation domain of c-Myc (aa 1-263) was removed and replaced with the amino terminal transcriptional repression domain (aa 1-38, the Sin3-interaction region) of Mad. | Backbone Size:0; Vector Backbone:n/a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Dominant negative mutant | 2026-08-15 01:09:30 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
