Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: ISAepa1 TnpB
Vector Backbone Description: Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:37386294
Proper citation: RRID:Addgene_205325 Copy
Species: Other
Genetic Insert: ISCysp13 TnpB
Vector Backbone Description: Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:37386294
Proper citation: RRID:Addgene_205338 Copy
Species: Other
Genetic Insert: ISClte2 TnpB
Vector Backbone Description: Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:37386294
Proper citation: RRID:Addgene_205334 Copy
Species: Other
Genetic Insert: CMV-LacZ
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:32705; Vector Backbone:pAdenoX; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_73345 Copy
Species: Other
Genetic Insert: CMV-copGFP
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:32705; Vector Backbone:pAdenoX; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_73346 Copy
Species: Other
Genetic Insert: shRNA to Luciferase
Vector Backbone Description: Backbone Marker:Clonetech; Vector Backbone:pSIREN RetroQ; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28969075
Proper citation: RRID:Addgene_73666 Copy
Species: Other
Genetic Insert: 2xNLS-mCherry + Cbr-unc-119
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73725 Copy
Species: Other
Genetic Insert: mCherry + Cbr-unc-119
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73724 Copy
Species: Other
Genetic Insert: tagRFP + Cbr-unc-119
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73723 Copy
Species: Other
Genetic Insert: syntron embedded C-terminal FLP-on
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73728 Copy
Species: Other
Genetic Insert: Unc-32::GFP(Cbr-unc-119)
Vector Backbone Description: Vector Backbone:pMLS256; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26837755
Comments: 2nd Insert: pU6::Unc-32 sgRNA; oMLS471: 5' - TCCAAGAACTCGTACAAAAATGCTC
Proper citation: RRID:Addgene_73719 Copy
Species: Other
Genetic Insert: SapI repair template insertion site
Vector Backbone Description: Backbone Marker:Agilent Technologies; Vector Backbone:pBluescript II; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73716 Copy
Species: Other
Genetic Insert: N-terminal FLP-on
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73733 Copy
Species: Other
Genetic Insert: FLAGtag-TEV
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73731 Copy
Species: Other
Genetic Insert: Flexible Linker
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73735 Copy
Species: Other
Genetic Insert: shRNA that targets the LacZ gene
Vector Backbone Description: Backbone Size:5568; Vector Backbone:pCAG-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25155555
Comments: The shRNA cassette was obtained via the BLOCK-iTTM PolII miR RNAi Express (Life Technologies).
Proper citation: RRID:Addgene_73978 Copy
Species: Other
Genetic Insert: Photinus pyralis sulfotransferase 2
Vector Backbone Description: Backbone Marker:Produced in Jing-Ke Weng lab; Backbone Size:5350; Vector Backbone:pHis8-4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27227579
Comments: Expresses robustly in E.coli. Minimal activity for desulfonation of p-nitrophenolsulfate with PAP
Proper citation: RRID:Addgene_74122 Copy
Species: Other
Genetic Insert: Green Lantern Green Fluorescent Protein
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4110; Vector Backbone:pSport I; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25448690
Proper citation: RRID:Addgene_74101 Copy
Species: Other
Genetic Insert: LacZ sgRNA
Vector Backbone Description: Backbone Marker:Moffat Lab; Vector Backbone:pLCKO; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26627737
Proper citation: RRID:Addgene_74179 Copy
Species: Other
Genetic Insert: Cas9
Vector Backbone Description: Vector Backbone:pMZ374; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_74215 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
