Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Hes1 Promoter (-467 to +46)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5597; Vector Backbone:pGL2-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9570950
Comments: Alternate plasmid name: Hes1-Luc
Proper citation: RRID:Addgene_41723 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SEC63-mRFP
Vector Backbone Description: Vector Backbone:pRS426; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18812321
Comments: Please note that Addgene's quality control sequence shows several discrepancies with depositor's reference sequence. These are in vector region and should not affect function.
Proper citation: RRID:Addgene_41842 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6577; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23852599
Proper citation: RRID:Addgene_41841 Copy
Genetic Insert: RLuc110UGA
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4079; Vector Backbone:pRL-CMV; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19208811
Proper citation: RRID:Addgene_41729 Copy
Species: Homo sapiens
Genetic Insert: apoptosis-associated speck-like protein containing CARD
Vector Backbone Description: Backbone Size:7332; Vector Backbone:pRP_LmCerulean; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23852599
Proper citation: RRID:Addgene_41840 Copy
Species: Mus musculus
Genetic Insert: Mus musculus GABA transporter 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19948998
Comments: To generate the fluorescent mutants mGAT10XFP and mGAT1XFP* through mGAT1XFP45, the wild-type mGAT1 open reading frame (ORF) was subcloned without its original stop codon into the HindIII and EcoRI sites of the pcDNA3.1(+) expression vector multiple cloning site (MCS). XFP ORFs were then subcloned downstream from and in frame with the mGAT1 ORF at the NotI and XbaI sites of the pcDNA3.1(+) MCS. This resulted in a 12–amino acid spacer between the end of the mGAT1 sequence and the beginning of the fluorophore. The depositors modified a method for the integration of PCR fragments without the use of restriction enzymes (Geiser et al., 2001) to add the final 3, 8, 20, 28, or 45 codons of the human GAT1 (hGAT1) ORF. These were amplified from a source plasmid using the proof-reading PfuTurbo Cx Hotstart polymerase with 5′ and 3′ extensions corresponding to the 20–22-nt regions that flanked the intended site of insertion, such that the PCR product integrated in-frame immediately after the fluorophore sequence when used as the primers in a subsequent QuikChange II XL mutagenesis PCR reaction. For mGAT1XFP*, the depositors simply added a GTC codon for Val after the fluorophore ORF.
The attached image displays the protein sequences of the modified regions of mGAT1 for each fluorescent construct. mGAT10CFP and mGAT10YFP repeated the fusion design of mGAT10GFP but with the fluorophore exchanged as annotated. The three C-terminal residues of the mGAT0XFP fusions are -YKI-CO2−, which comprises a broadly defined consensus PDZ class II–interacting motif (X-φ-X-φ, where φ designates a hydrophobic residue and X any residue) (Sheng and Sala, 2001; Hung and Sheng, 2002). The depositors searched the Ensembl databases using Biomart (http://www.ebi.ac.uk/biomart) (Spudich et al., 2007) and applied the GO:0005886 “plasma membrane” cellular component filter. The search identified no known membrane proteins possessing the -YKI-CO2− C-terminal sequence.
In the mGAT1XFP* constructs, the depositors defined the terminal residue P(0) more narrowly, changing the terminal isoleucine residue present in mGAT10XFP to a valine in mGAT1XFP*. The resulting C-terminal sequence, -YKV-CO2−, reconstituted a functional PDZ class II–interacting motif present in Ephrin B receptors, a class that relies on interactions with the PDZ domain–containing proteins for clustering (Torres et al., 1998; Brückner et al., 1999; Lin et al., 1999; Madsen et al., 2005).
Other constructs in the C-terminal XFP fusion series, mGAT1XFP3, mGAT1XFP8, mGAT1XFP20, mGAT1XFP28, and mGAT1XFP45, had the most C-terminal 3, 8, 20, 28, or 45 residues of the hGAT1 appended after the mGAT1XFP fusion. The differences in nucleotide sequence between the hGAT1 and mGAT1 C termini were a useful source of positive identification when the depositors analyzed the clones during construction.
PCR integration was applied to amplify and insert EYFP or ECFP directly between residues R565 and L566, I570 and Q571, or V577 and R578 of mGAT1 to generate the mGAT15xxXFP5xxCT constructs. The site of XFP insertion in GAT1 is highlighted in the nomenclatures for these constructs by residue numbers flanking the fluorophore, and the “CT” denotes that the insertion occurs within the C terminus.
Please see the associated article for more detailed information regarding construct creation and usage.
Proper citation: RRID:Addgene_41682 Copy
Species: Mus musculus
Genetic Insert: Mus musculus GABA transporter 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19948998
Comments: To generate the fluorescent mutants mGAT10XFP and mGAT1XFP* through mGAT1XFP45, the wild-type mGAT1 open reading frame (ORF) was subcloned without its original stop codon into the HindIII and EcoRI sites of the pcDNA3.1(+) expression vector multiple cloning site (MCS). XFP ORFs were then subcloned downstream from and in frame with the mGAT1 ORF at the NotI and XbaI sites of the pcDNA3.1(+) MCS. This resulted in a 12–amino acid spacer between the end of the mGAT1 sequence and the beginning of the fluorophore. The depositors modified a method for the integration of PCR fragments without the use of restriction enzymes (Geiser et al., 2001) to add the final 3, 8, 20, 28, or 45 codons of the human GAT1 (hGAT1) ORF. These were amplified from a source plasmid using the proof-reading PfuTurbo Cx Hotstart polymerase with 5′ and 3′ extensions corresponding to the 20–22-nt regions that flanked the intended site of insertion, such that the PCR product integrated in-frame immediately after the fluorophore sequence when used as the primers in a subsequent QuikChange II XL mutagenesis PCR reaction. For mGAT1XFP*, the depositors simply added a GTC codon for Val after the fluorophore ORF.
The attached image displays the protein sequences of the modified regions of mGAT1 for each fluorescent construct. mGAT10CFP and mGAT10YFP repeated the fusion design of mGAT10GFP but with the fluorophore exchanged as annotated. The three C-terminal residues of the mGAT0XFP fusions are -YKI-CO2−, which comprises a broadly defined consensus PDZ class II–interacting motif (X-φ-X-φ, where φ designates a hydrophobic residue and X any residue) (Sheng and Sala, 2001; Hung and Sheng, 2002). The depositors searched the Ensembl databases using Biomart (http://www.ebi.ac.uk/biomart) (Spudich et al., 2007) and applied the GO:0005886 “plasma membrane” cellular component filter. The search identified no known membrane proteins possessing the -YKI-CO2− C-terminal sequence.
In the mGAT1XFP* constructs, the depositors defined the terminal residue P(0) more narrowly, changing the terminal isoleucine residue present in mGAT10XFP to a valine in mGAT1XFP*. The resulting C-terminal sequence, -YKV-CO2−, reconstituted a functional PDZ class II–interacting motif present in Ephrin B receptors, a class that relies on interactions with the PDZ domain–containing proteins for clustering (Torres et al., 1998; Brückner et al., 1999; Lin et al., 1999; Madsen et al., 2005).
Other constructs in the C-terminal XFP fusion series, mGAT1XFP3, mGAT1XFP8, mGAT1XFP20, mGAT1XFP28, and mGAT1XFP45, had the most C-terminal 3, 8, 20, 28, or 45 residues of the hGAT1 appended after the mGAT1XFP fusion. The differences in nucleotide sequence between the hGAT1 and mGAT1 C termini were a useful source of positive identification when the depositors analyzed the clones during construction.
PCR integration was applied to amplify and insert EYFP or ECFP directly between residues R565 and L566, I570 and Q571, or V577 and R578 of mGAT1 to generate the mGAT15xxXFP5xxCT constructs. The site of XFP insertion in GAT1 is highlighted in the nomenclatures for these constructs by residue numbers flanking the fluorophore, and the “CT” denotes that the insertion occurs within the C terminus.
Please see the associated article for more detailed information regarding construct creation and usage.
Proper citation: RRID:Addgene_41681 Copy
Species: Mus musculus
Genetic Insert: Mus musculus GABA transporter 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19948998
Comments: To generate the fluorescent mutants mGAT10XFP and mGAT1XFP* through mGAT1XFP45, the wild-type mGAT1 open reading frame (ORF) was subcloned without its original stop codon into the HindIII and EcoRI sites of the pcDNA3.1(+) expression vector multiple cloning site (MCS). XFP ORFs were then subcloned downstream from and in frame with the mGAT1 ORF at the NotI and XbaI sites of the pcDNA3.1(+) MCS. This resulted in a 12–amino acid spacer between the end of the mGAT1 sequence and the beginning of the fluorophore. The depositors modified a method for the integration of PCR fragments without the use of restriction enzymes (Geiser et al., 2001) to add the final 3, 8, 20, 28, or 45 codons of the human GAT1 (hGAT1) ORF. These were amplified from a source plasmid using the proof-reading PfuTurbo Cx Hotstart polymerase with 5′ and 3′ extensions corresponding to the 20–22-nt regions that flanked the intended site of insertion, such that the PCR product integrated in-frame immediately after the fluorophore sequence when used as the primers in a subsequent QuikChange II XL mutagenesis PCR reaction. For mGAT1XFP*, the depositors simply added a GTC codon for Val after the fluorophore ORF.
The attached image displays the protein sequences of the modified regions of mGAT1 for each fluorescent construct. mGAT10CFP and mGAT10YFP repeated the fusion design of mGAT10GFP but with the fluorophore exchanged as annotated. The three C-terminal residues of the mGAT0XFP fusions are -YKI-CO2−, which comprises a broadly defined consensus PDZ class II–interacting motif (X-φ-X-φ, where φ designates a hydrophobic residue and X any residue) (Sheng and Sala, 2001; Hung and Sheng, 2002). The depositors searched the Ensembl databases using Biomart (http://www.ebi.ac.uk/biomart) (Spudich et al., 2007) and applied the GO:0005886 “plasma membrane” cellular component filter. The search identified no known membrane proteins possessing the -YKI-CO2− C-terminal sequence.
In the mGAT1XFP* constructs, the depositors defined the terminal residue P(0) more narrowly, changing the terminal isoleucine residue present in mGAT10XFP to a valine in mGAT1XFP*. The resulting C-terminal sequence, -YKV-CO2−, reconstituted a functional PDZ class II–interacting motif present in Ephrin B receptors, a class that relies on interactions with the PDZ domain–containing proteins for clustering (Torres et al., 1998; Brückner et al., 1999; Lin et al., 1999; Madsen et al., 2005).
Other constructs in the C-terminal XFP fusion series, mGAT1XFP3, mGAT1XFP8, mGAT1XFP20, mGAT1XFP28, and mGAT1XFP45, had the most C-terminal 3, 8, 20, 28, or 45 residues of the hGAT1 appended after the mGAT1XFP fusion. The differences in nucleotide sequence between the hGAT1 and mGAT1 C termini were a useful source of positive identification when the depositors analyzed the clones during construction.
PCR integration was applied to amplify and insert EYFP or ECFP directly between residues R565 and L566, I570 and Q571, or V577 and R578 of mGAT1 to generate the mGAT15xxXFP5xxCT constructs. The site of XFP insertion in GAT1 is highlighted in the nomenclatures for these constructs by residue numbers flanking the fluorophore, and the “CT” denotes that the insertion occurs within the C terminus.
Please see the associated article for more detailed information regarding construct creation and usage.
Proper citation: RRID:Addgene_41680 Copy
Species: Mus musculus
Genetic Insert: Numb
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16832352
Proper citation: RRID:Addgene_41712 Copy
Species: Mus musculus
Genetic Insert: tet methylcytosine dioxygenase 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6174; Vector Backbone:pEF1a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21057493
Proper citation: RRID:Addgene_41710 Copy
Genetic Insert: satellite repeat sequence
Vector Backbone Description: Vector Backbone:p156RRLsinpptCAGPRE; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21901007
Proper citation: RRID:Addgene_41795 Copy
Genetic Insert: HIV-1 Gag/Pol and RRE sequences
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22612657
Proper citation: RRID:Addgene_41791 Copy
Genetic Insert: E. coli MG1655 ΔmutS::cat Δ(ybhB-bioAB)::[λcI857 N(cro-ea59)::tetR-bla] dnaG.Q576A
Vector Backbone Description: Vector Backbone:genome; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22904085
Proper citation: RRID:Addgene_41700 Copy
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.3-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23287722
Comments: For additional information:
http://arep.med.harvard.edu/human_crispr/
Proper citation: RRID:Addgene_41815 Copy
Species: Homo sapiens
Genetic Insert: SOX2, KLF4
Vector Backbone Description: Backbone Size:9364; Vector Backbone:pCE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23193063
Proper citation: RRID:Addgene_41814 Copy
Genetic Insert: gRNA_AAVS1-T2
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23287722
Comments: gRNA target sequence GGGGCCACTAGGGACAGGAT
Proper citation: RRID:Addgene_41818 Copy
Genetic Insert: gRNA_AAVS1-T1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23287722
Comments: gRNA target sequence GTCCCCTCCACCCCACAGTG
Proper citation: RRID:Addgene_41817 Copy
Species: Homo sapiens
Genetic Insert: Halotag 2
Vector Backbone Description: Backbone Marker:INVITROGEN; Backbone Size:5000; Vector Backbone:PCDNA5; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21725302
Comments: Alternate plasmid name: pCDNA5-KGH2
Proper citation: RRID:Addgene_41742 Copy
Genetic Insert: E. coli MG1655 ΔmutS::cat Δ(ybhB-bioAB)::[λcI857 N(cro-ea59)::tetR-bla] xonA-, recJ-,xseA-, exoX- and redα- dnaG.Q576A tolC-
Vector Backbone Description: Vector Backbone:genome; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22904085
Proper citation: RRID:Addgene_41699 Copy
Species: Mus musculus
Genetic Insert: Notch-1 Intracellular Domain
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9620803
Comments: Alternate plasmid name: pCS2 NICv1744-6MT
To create pCS2+ NICV1744, the primer CCAGGATCCACCATGGTGCTGCTGTCCCGCAAGC was used with primer M95 (5'-TCGAACATTGACATCCATGCA-3') to generate a product that was digested with Bam HI and Bcl I, and ligated into the same sites in NΔE (Addgene plasmid #41737).
Proper citation: RRID:Addgene_41730 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.