Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: vang-like 2
Vector Backbone Description: Backbone Size:4224; Vector Backbone:pAdLox GI 1488684; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16791850
Comments: contains EGFP hVangl2 WT
Proper citation: RRID:Addgene_37257 Copy
Genetic Insert: LSSmOrange
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6655; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22486524
Proper citation: RRID:Addgene_37139 Copy
Genetic Insert: LSSmOrange-DEVD-mKate2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3959; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22486524
Proper citation: RRID:Addgene_37132 Copy
Genetic Insert: LSSmOrange
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4013; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22486524
Proper citation: RRID:Addgene_37130 Copy
Species: Homo sapiens
Genetic Insert: Mff1
Vector Backbone Description: Backbone Marker:OligoEngine; Backbone Size:6350; Vector Backbone:pSuper-Retro-Puro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822277
Proper citation: RRID:Addgene_37247 Copy
Species: Synthetic
Genetic Insert: TdTomato-EGFP
Vector Backbone Description: Backbone Marker:K. Deisseroth Lab; Backbone Size:5627; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Switch; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22866029
Proper citation: RRID:Addgene_37120 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:K. Deisseroth Lab; Backbone Size:5613; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Off; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22866029
Proper citation: RRID:Addgene_37119 Copy
Vector Backbone Description: Backbone Size:4776; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. For more details, see the MacroLab vector cloning manual.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2Bc-T has a TEV-cleavable C-terminal His6 tag to ease purification.
To clone into this vector, add LIC v3 tags to the 5' end of your PCR primers.
Forward - 5'TTTAAGAAGGAGATATAGTTC(ATG)3'
Reverse - 5'GGATTGGAAGTAGAGGTTCTC3'
Linearize the plasmid with HpaI and gel purify.
When digesting the DNA with T4 polymerase, use dGTP for insert and dCTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_37236 Copy
Species: Synthetic
Genetic Insert: NLS YFP
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21397594
Proper citation: RRID:Addgene_37341 Copy
Species: Synthetic
Genetic Insert: membrane Venus
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21397594
Proper citation: RRID:Addgene_37343 Copy
Species: Aequorea victoria
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:15709003
Proper citation: RRID:Addgene_37329 Copy
Species: Homo sapiens
Genetic Insert: HPV45L1+L2
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17603495
Proper citation: RRID:Addgene_37323 Copy
Species: Homo sapiens
Genetic Insert: HPV58L1+L2
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17010405
Proper citation: RRID:Addgene_37324 Copy
Species: Homo sapiens
Genetic Insert: HsNot7
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4769; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21981923
Proper citation: RRID:Addgene_37325 Copy
Species: Homo sapiens
Genetic Insert: SEAP
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Blasticidin
Defining Citation: PMID:15051381
Proper citation: RRID:Addgene_37326 Copy
Species: Homo sapiens
Genetic Insert: HPV31L1+L2
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17603495
Proper citation: RRID:Addgene_37322 Copy
Vector Backbone Description: Backbone Size:4168; Vector Backbone:pCS2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22916025
Comments: For more information on Grunwald TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#grunwald
Proper citation: RRID:Addgene_37275 Copy
Species: Homo sapiens
Genetic Insert: Ran
Vector Backbone Description: Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22327364
Comments: Please note that Addgene's sequencing result exactly matches the full plasmid sequence provided by the depositing laboratory; however, when these sequences are compared to GenBank ID NP_006316.1 there appears to be a T24N mutation.
Proper citation: RRID:Addgene_37396 Copy
Vector Backbone Description: Backbone Size:4039; Vector Backbone:pCS2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22916025
Comments: For more information on Grunwald TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#grunwald
Proper citation: RRID:Addgene_37276 Copy
Species: Arabidopsis thaliana
Genetic Insert: GAI
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pECFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22446836
Proper citation: RRID:Addgene_37310 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
