Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: S. pyogenes
Genetic Insert: tracrRNA
Vector Backbone Description: Vector Backbone:pACYC184; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:23761437
Proper citation: RRID:Addgene_46569 Copy
Species: Homo sapiens
Genetic Insert: SHP-2(NC)
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 49.2 kDa
Proper citation: RRID:Addgene_46499 Copy
Species: Mus musculus
Genetic Insert: Sox10
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7791; Vector Backbone:pLVX-Tight-Puro; Vector Types:Mammalian Expression, Bacterial Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23584611
Proper citation: RRID:Addgene_46536 Copy
Species: Homo sapiens
Genetic Insert: Sap
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 38.9 kDa
Proper citation: RRID:Addgene_46477 Copy
Species: Homo sapiens
Genetic Insert: Src
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 37.5 kDa
Proper citation: RRID:Addgene_46510 Copy
Species: Homo sapiens
Genetic Insert: SH2-B
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 38.9 kDa
Proper citation: RRID:Addgene_46479 Copy
Species: Homo sapiens
Genetic Insert: miR-375 Decoy
Vector Backbone Description: Backbone Size:8233; Vector Backbone:AB.pCCLsin.PPT.U6.hPGK.GFP.wpre; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22751203
Comments: Depositor Website: http://www.mountsinai.org/profiles/brian-d-brown/ Please cite Mullokandov, Baccarini, Ruzo et al. Nature Methods 2013.
Proper citation: RRID:Addgene_46617 Copy
Species: Homo sapiens
Genetic Insert: hsa-mir-133a-1
Vector Backbone Description: Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23415231
Proper citation: RRID:Addgene_46676 Copy
Vector Backbone Description: Backbone Marker:unknown; Backbone Size:4980; Vector Backbone:pBR322; Vector Types:sequencing vector; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:21410291
Proper citation: RRID:Addgene_46858 Copy
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2960; Vector Backbone:pBluescript SK(+); Vector Types:Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21445009
Proper citation: RRID:Addgene_46848 Copy
Genetic Insert: Coral Green Fluorescent Protein (cGFP)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23073843
Proper citation: RRID:Addgene_46835 Copy
Species: Homo sapiens
Genetic Insert: PGK
Vector Backbone Description: Backbone Marker:Richard Mulligan; Backbone Size:4874; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20038801
Proper citation: RRID:Addgene_46793 Copy
Species: Mus musculus
Genetic Insert: Bmal1
Vector Backbone Description: Backbone Marker:Addgene plasmid 12254; Vector Backbone:pWPI; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16167846
Comments: The insert consists of 1 kb of mouse Bmal1 upstream region and 53 nucleotides of exon 1, fused in-frame to the luciferase coding region, and followed by 1 kb of Bmal1 3′UTR.
Proper citation: RRID:Addgene_46824 Copy
Species: Homo sapiens
Genetic Insert: GNA13
Vector Backbone Description: Backbone Marker:Dr. Richard Iggo, University of St Andrews, Edinburgh, UK; Backbone Size:9195; Vector Backbone:psd44; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: cDNA to make this plasmid was obtained from www.cdna.org (ID GNA1300000).
Proper citation: RRID:Addgene_46829 Copy
Species: Homo sapiens
Genetic Insert: RAB11A S25N
Vector Backbone Description: Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16959776
Comments: cDNA was obtained from UMR cDNA Resource Center, www.cdna.org
To make mutation, the following primers were used for PCR amplification:
Rab11 S25N FWD (5′-AGCTCGGATCCACCATGGGCACCCGCGACGACGAGT
ACGACTACCTCTTTAAAGTTGTCCTTATTGGAGATTCTGGTGTTGGAAAGAATAATCTCCTGTCT-3′)
BGH RVS primer (5′-TAGAAGGCACAGTCGAGG-3′)
Proper citation: RRID:Addgene_46786 Copy
Species: Homo sapiens
Genetic Insert: RAB8A
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16959776
Comments: Also see Dupré et al., 2006 Cell Signal. 2007 Mar;19(3):481-9. https://www.ncbi.nlm.nih.gov/pubmed/16979872 for more information.
Proper citation: RRID:Addgene_46783 Copy
Vector Backbone Description: Vector Backbone:pSP-G1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24161108
Proper citation: RRID:Addgene_46814 Copy
Vector Backbone Description: Vector Backbone:pCEV-G2-Km; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24161108
Proper citation: RRID:Addgene_46819 Copy
Species: Homo sapiens
Genetic Insert: Rab1a
Vector Backbone Description: Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16959776
Comments: cDNA was obtained from UMR cDNA Resource Center, www.cdna.org .
Also see Dupré et al., 2006 Cell Signal. 2007 Mar;19(3):481-9. https://www.ncbi.nlm.nih.gov/pubmed/16979872 for more information.
Proper citation: RRID:Addgene_46776 Copy
Species: Homo sapiens
Genetic Insert: Rab1a S25N mutant
Vector Backbone Description: Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16959776
Comments: cDNA was obtained from UMR cDNA Resource Center, www.cdna.org
To make mutation, the following primers were used for PCR amplification:
Rab1 S25N FWD (5′-AGCTCGGATCCACCATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGACTCAGGGGTTGGAAAGAATTGCCTTCTTCT-3′)
BGH RVS primer (5′-TAGAAGGCACAGTCGAGG-3′)
Proper citation: RRID:Addgene_46777 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
