Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: B. subtilis
Genetic Insert: sacB
Vector Backbone Description: Backbone Marker:Philip Poole lab; Backbone Size:3417; Vector Backbone:pBBR1-Gm-ELT3 (pOGG024); Vector Types:; Bacterial Resistance:Gentamicin
Defining Citation: PMID:38715147
Proper citation: RRID:Addgene_222335 Copy
Species: Enterobacteriaceae
Genetic Insert: peptidyl-prolyl cis-trans isomerase (ppiB)
Vector Backbone Description: Vector Backbone:pCOLA; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:39059674
Proper citation: RRID:Addgene_202482 Copy
Species: Synthetic
Genetic Insert: SOX (K250A)
Vector Backbone Description: Backbone Marker:Geneva Biotech; Backbone Size:3400; Vector Backbone:pACEmam1; Vector Types:Unspecified; Bacterial Resistance:Gentamicin
Defining Citation: PMID:36537232
Proper citation: RRID:Addgene_192052 Copy
Species: Synthetic
Genetic Insert: SOX (D221N E244Q)
Vector Backbone Description: Backbone Marker:Geneva Biotech; Backbone Size:3400; Vector Backbone:pACEmam1; Vector Types:Unspecified; Bacterial Resistance:Gentamicin
Defining Citation: PMID:36537232
Proper citation: RRID:Addgene_192053 Copy
Species: Homo sapiens
Genetic Insert: MZT2A
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178074 Copy
Species: Homo sapiens
Genetic Insert: GCP5
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178071 Copy
Species: Homo sapiens
Genetic Insert: GCP6
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178072 Copy
Species: Homo sapiens
Genetic Insert: gamma-tubulin with an N229A point mutation
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Comments: Primers used to generate pACEBac1-gamma-tubulin(N229A)-TEV-His6 via site-directed mutagenesis were CCCATCCTTCTCCCAGATCGCCCAGCTGGTGTCTACCATCATGTC and GACATGATGGTAGACACCAGCTGGGCGATCTGGGAGAAGGATGGG
Proper citation: RRID:Addgene_178077 Copy
Species: Homo sapiens
Genetic Insert: MZT1
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178075 Copy
Species: Homo sapiens
Genetic Insert: beta-actin
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178076 Copy
Species: Homo sapiens
Genetic Insert: gamma-tubulin
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178067 Copy
Vector Backbone Description: Vector Backbone:pUC18; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:26341612
Comments: See J. Microbio. Methods 2015 118:75-79 for details
The authors used this vector along with a Tn7 transposase encoding plasmid, pTNS1.
Proper citation: RRID:Addgene_70115 Copy
Species: Mus musculus
Genetic Insert: BICD2N (1-400)
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pOmniBac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:24986880
Proper citation: RRID:Addgene_64070 Copy
Genetic Insert: oriR6K
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18T-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:15908923
Comments: Genbank Accession #AY884833
Proper citation: RRID:Addgene_64966 Copy
Genetic Insert: FRT-GmR-FRT
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pFRT2; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:15908923
Comments: GenBank Accession #AY597270
Compared to the Genbank reference sequence AY597270, Addgene's sequencing results found a R98K mutation in the gentamycin cassette. The effect of this difference is unknown.
Proper citation: RRID:Addgene_64949 Copy
Vector Backbone Description: Backbone Marker:Beckwith Lab; Vector Backbone:pBAD33; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:19151135
Proper citation: RRID:Addgene_65098 Copy
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:17406227
Comments: GenBank Accession # DQ296496
Compared to the Genbank reference sequence DQ296496, Addgene's sequencing results found T920I, D999E and F1000L mutations in lacZ. The effect of these differences is unknown. Note that the amino acid numbering is relative to the lacZ encoded by this plasmid.
Proper citation: RRID:Addgene_65028 Copy
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18R6K-mini-Tn7T; Vector Types:; Bacterial Resistance:Gentamicin
Defining Citation: PMID:17406227
Comments: GenBank Accession # AY599228
Proper citation: RRID:Addgene_65022 Copy
Genetic Insert: ecfp
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18T-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:17406227
Comments: GenBank Accession # DQ493878
Proper citation: RRID:Addgene_65030 Copy
Vector Backbone Description: Vector Backbone:pUC18T-mini-Tn7T-oriT; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:15908923
Proper citation: RRID:Addgene_63121 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
