Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:kanamycin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

33,834 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
EGFP-bSV-171-1792
 
Resource Report
Resource Website 		RRID:Addgene_41661 supervillin Bos taurus Kanamycin PMID:10362542 Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin amino acids 171-1792 2026-08-15 01:14:47 0
TAL-BBL1-ID14
 
Resource Report
Resource Website 		RRID:Addgene_41516 Polylinker flanked by 2 Mva1269I cut sites Synthetic Kanamycin PMID:23242165 Backbone Marker:Clontech; Backbone Size:2638; Vector Backbone:pEGFP-N1Δ4728-2101; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:46 0
pSKDuet26
 
Resource Report
Resource Website 		RRID:Addgene_41689 Tvo VMA intein Thermoplasma volcanium Kanamycin PMID:22001202 Backbone Marker:novagen; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:47 0
gRNA_DNMT3b
 
Resource Report
Resource Website 		RRID:Addgene_41823 gRNA_DNMT3b Homo sapiens Kanamycin PMID:23287722 gRNA target sequence GAATTACTCACGCCCCAAGG Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:14:48 0
gRNA_AAVS1-T2
 
Resource Report
Resource Website
50+ mentions 		RRID:Addgene_41818 gRNA_AAVS1-T2 Kanamycin PMID:23287722 gRNA target sequence GGGGCCACTAGGGACAGGAT Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:14:48 51
gRNA_AAVS1-T1
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_41817 gRNA_AAVS1-T1 Kanamycin PMID:23287722 gRNA target sequence GTCCCCTCCACCCCACAGTG Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:14:48 13
pSKDuet21
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41695 PhoCDC21-1 intein Pyrococcus horikoshii Kanamycin PMID:22001202 Backbone Marker:novagen; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:47 1
pSKDuet20
 
Resource Report
Resource Website 		RRID:Addgene_41694 MjaTFIIB intein Methanococcus jannaschii Kanamycin PMID:22001202 Backbone Marker:novagen; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:47 0
pDZ50
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41948 ubiquitin specific peptidase 28 Homo sapiens Kanamycin PMID:16901786 Backbone Size:4261; Vector Backbone:phCMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:49 2
pET-GST-TNRC6A-(935-984)
 
Resource Report
Resource Website 		RRID:Addgene_42050 TNRC6A Homo sapiens Kanamycin PMID:23150874 Backbone Size:5311; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin contain aa935-984 2026-08-15 01:14:50 0
pET-GST-TNRC6A-(935-984)-NES-mut
 
Resource Report
Resource Website 		RRID:Addgene_42051 TNRC6A Homo sapiens Kanamycin PMID:23150874 Backbone Size:5311; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin contain aa935-984, F951A, F955A, I958A, F960A 2026-08-15 01:14:50 0
pCMV-N1-mouse-superfolderGFP (mGRASP)
 
Resource Report
Resource Website 		RRID:Addgene_42143 pCMV-N1-superfolderGFP Synthetic Kanamycin PMID:22355283 Vector Backbone:pNICE; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:51 0
DR274
 
Resource Report
Resource Website
100+ mentions 		RRID:Addgene_42250 Kanamycin PMID:23360964 Backbone Marker:Joung lab DR274; Backbone Size:2147; Vector Backbone:Zebrafish-gRNA-ExpressionVector; Vector Types:Worm Expression, CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:52 213
Zebrafish-gRNA-0008
 
Resource Report
Resource Website 		RRID:Addgene_42248 gRNA-tia1l Danio rerio Kanamycin PMID:23360964 Target site: GGTATGTCGGGAACCTCTCC Guide RNA sequence: TAATACGACTCACTATAGGTATGTCGGGAACCTCTCCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:52 0
Zebrafish-gRNA-0002
 
Resource Report
Resource Website 		RRID:Addgene_42242 gRNA-drd3 Danio rerio Kanamycin PMID:23360964 Target site: GGAAACTACAGCCCAGCGTC Guide RNA sequence: TAATACGACTCACTATAGGAAACTACAGCCCAGCGTCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:51 0
Zebrafish-gRNA-0003
 
Resource Report
Resource Website 		RRID:Addgene_42243 gRNA-fh site #1 Danio rerio Kanamycin PMID:23360964 Target site: GGAGCGGTACATGGCGACCG Guide RNA sequence: TAATACGACTCACTATAGGAGCGGTACATGGCGACCGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:51 0
Zebrafish-gRNA-0006
 
Resource Report
Resource Website 		RRID:Addgene_42246 gRNA-rgs4 Danio rerio Kanamycin PMID:23360964 Target site: GGAGAAGGTGAAGGACACTG Guide RNA sequence: TAATACGACTCACTATAGGAGAAGGTGAAGGACACTGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:51 0
pENTR-3xFLAG-YAP1-S127A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_42239 YAP1 Homo sapiens Kanamycin PMID:22308401 Backbone Marker:Invitrogen; Backbone Size:2300; Vector Backbone:pEntr3c; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin Serine 127 changed to alanine 2026-08-15 01:14:51 1
Fz4-GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_42197 Frizzled 4 Mus musculus Kanamycin PMID:12958364 Fz4-GFP was generated by fusing EGFP (Clontech) at its C-terminus. Alternate plasmid names: pEGFPN2 mFz4; pEGFP-N2-Frizzled4 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:51 3
pC1-PIP-SHOW
 
Resource Report
Resource Website 		RRID:Addgene_42212 PIP-SHOW Synthetic Kanamycin PMID:22369174 Backbone Size:3931; Vector Backbone:pC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:51 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch