Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pLK65 Resource Report Resource Website 1+ mentions |
RRID:Addgene_37257 | vang-like 2 | Homo sapiens | Ampicillin | PMID:16791850 | contains EGFP hVangl2 WT | Backbone Size:4224; Vector Backbone:pAdLox GI 1488684; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 1 | |
|
pActinin-LSSmOrange Resource Report Resource Website 1+ mentions |
RRID:Addgene_37139 | LSSmOrange | Kanamycin | PMID:22486524 | Backbone Marker:Clontech; Backbone Size:6655; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | A44V/F84L/W145M/I165D/M167L/G202D compared to mOrange (but numbering relative to EGFP) | 2026-08-15 01:14:13 | 2 | ||
|
pLSSmOrange-mKate2 caspase-3 biosensor Resource Report Resource Website 1+ mentions |
RRID:Addgene_37132 | LSSmOrange-DEVD-mKate2 | Kanamycin | PMID:22486524 | Backbone Marker:Clontech; Backbone Size:3959; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | A44V/F84L/W145M/I165D/M167L/G202D compared to mOrange (but numbering relative to EGFP) | 2026-08-15 01:14:12 | 1 | ||
|
pLSSmOrange-N1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_37130 | LSSmOrange | Kanamycin | PMID:22486524 | Backbone Marker:Clontech; Backbone Size:4013; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | A44V/F84L/W145M/I165D/M167L/G202D compared to mOrange (but numbering relative to EGFP) | 2026-08-15 01:14:12 | 2 | ||
|
pSR-puro-Mff1 shRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_37247 | Mff1 | Homo sapiens | Ampicillin | PMID:21822277 | Backbone Marker:OligoEngine; Backbone Size:6350; Vector Backbone:pSuper-Retro-Puro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 1 | ||
|
pAAV-Ef1a-DO_DIO-TdTomato_EGFP-WPRE-pA Resource Report Resource Website 10+ mentions |
RRID:Addgene_37120 | TdTomato-EGFP | Synthetic | Ampicillin | PMID:22866029 | Backbone Marker:K. Deisseroth Lab; Backbone Size:5627; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Switch; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:12 | 18 | ||
|
pAAV-Ef1a-DO-mCherry-WPRE-pA Resource Report Resource Website 1+ mentions |
RRID:Addgene_37119 | mCherry | Synthetic | Ampicillin | PMID:22866029 | Backbone Marker:K. Deisseroth Lab; Backbone Size:5613; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Off; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:12 | 3 | ||
|
pET His6 LIC cloning vector (2Bc-T) Resource Report Resource Website 1+ mentions |
RRID:Addgene_37236 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. For more details, see the MacroLab vector cloning manual. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2Bc-T has a TEV-cleavable C-terminal His6 tag to ease purification. To clone into this vector, add LIC v3 tags to the 5' end of your PCR primers. Forward - 5'TTTAAGAAGGAGATATAGTTC(ATG)3' Reverse - 5'GGATTGGAAGTAGAGGTTCTC3' Linearize the plasmid with HpaI and gel purify. When digesting the DNA with T4 polymerase, use dGTP for insert and dCTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:4776; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 5 | ||||
|
pQC NLS YFP IX Resource Report Resource Website 1+ mentions |
RRID:Addgene_37341 | NLS YFP | Synthetic | Ampicillin | PMID:21397594 | Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 3 | ||
|
pQC membrane Venus IX Resource Report Resource Website 1+ mentions |
RRID:Addgene_37343 | membrane Venus | Synthetic | Ampicillin | PMID:21397594 | Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 1 | ||
|
pfwB Resource Report Resource Website 1+ mentions |
RRID:Addgene_37329 | GFP | Aequorea victoria | Bleocin (Zeocin) | PMID:15709003 | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:14:14 | 4 | ||
|
p45sheLL Resource Report Resource Website 1+ mentions |
RRID:Addgene_37323 | HPV45L1+L2 | Homo sapiens | Ampicillin | PMID:17603495 | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 4 | ||
|
p58sheLL Resource Report Resource Website 1+ mentions |
RRID:Addgene_37324 | HPV58L1+L2 | Homo sapiens | Ampicillin | PMID:17010405 | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 3 | ||
|
pT7-EGFP-C1-HsNot7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_37325 | HsNot7 | Homo sapiens | Kanamycin | PMID:21981923 | Backbone Marker:Clontech; Backbone Size:4769; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:14 | 1 | ||
|
pYSEAP Resource Report Resource Website 1+ mentions |
RRID:Addgene_37326 | SEAP | Homo sapiens | Blasticidin | PMID:15051381 | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Blasticidin | 2026-08-15 01:14:14 | 4 | ||
|
p31sheLL Resource Report Resource Website 1+ mentions |
RRID:Addgene_37322 | HPV31L1+L2 | Homo sapiens | Ampicillin | PMID:17603495 | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 4 | ||
|
pCS2TAL3-DD Resource Report Resource Website 10+ mentions |
RRID:Addgene_37275 | Ampicillin | PMID:22916025 | For more information on Grunwald TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#grunwald | Backbone Size:4168; Vector Backbone:pCS2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 12 | |||
|
pTK21 Resource Report Resource Website 1+ mentions |
RRID:Addgene_37396 | Ran | Homo sapiens | Kanamycin | PMID:22327364 | Please note that Addgene's sequencing result exactly matches the full plasmid sequence provided by the depositing laboratory; however, when these sequences are compared to GenBank ID NP_006316.1 there appears to be a T24N mutation. | Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | T24N | 2026-08-15 01:14:14 | 7 |
|
pCS2TAL3-RR Resource Report Resource Website 10+ mentions |
RRID:Addgene_37276 | Ampicillin | PMID:22916025 | For more information on Grunwald TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#grunwald | Backbone Size:4039; Vector Backbone:pCS2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 11 | |||
|
CFP-GAI(1-532) Resource Report Resource Website 1+ mentions |
RRID:Addgene_37310 | GAI | Arabidopsis thaliana | Kanamycin | PMID:22446836 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pECFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | contains aa 1-532 | 2026-08-15 01:14:14 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
