Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 160 showing 3181 ~ 3200 out of 328,630 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_46814

    This resource has 1+ mentions.

http://www.addgene.org/46814

Vector Backbone Description: Vector Backbone:pSP-G1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24161108

Proper citation: RRID:Addgene_46814 Copy   


  • RRID:Addgene_46819

    This resource has 1+ mentions.

http://www.addgene.org/46819

Vector Backbone Description: Vector Backbone:pCEV-G2-Km; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24161108

Proper citation: RRID:Addgene_46819 Copy   


  • RRID:Addgene_46774

http://www.addgene.org/46774

Species: Homo sapiens
Genetic Insert: B-domain deleted FVIII H4 (R484H)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Polymorphisms described in: Inhibitors of factor VIII in black patients with hemophilia. Viel KR, Ameri A, Abshire TC, Iyer RV, Watts RG, Lutcher C, Channell C, Cole SA, Fernstrom KM, Nakaya S, Kasper CK, Thompson AR, Almasy L, Howard TE. N Engl J Med. 2009 Apr 16;360(16):1618-27. doi: 10.1056/NEJMoa075760. Erratum in: N Engl J Med. 2009 Jul 30;361(5):544. PMID:1936966

Proper citation: RRID:Addgene_46774 Copy   


  • RRID:Addgene_46773

http://www.addgene.org/46773

Species: Homo sapiens
Genetic Insert: full length FVIII D1241E
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Polymorphisms described in: Inhibitors of factor VIII in black patients with hemophilia. Viel KR, Ameri A, Abshire TC, Iyer RV, Watts RG, Lutcher C, Channell C, Cole SA, Fernstrom KM, Nakaya S, Kasper CK, Thompson AR, Almasy L, Howard TE. N Engl J Med. 2009 Apr 16;360(16):1618-27. doi: 10.1056/NEJMoa075760. Erratum in: N Engl J Med. 2009 Jul 30;361(5):544. PMID:1936966

Proper citation: RRID:Addgene_46773 Copy   


  • RRID:Addgene_46776

    This resource has 1+ mentions.

http://www.addgene.org/46776

Species: Homo sapiens
Genetic Insert: Rab1a
Vector Backbone Description: Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16959776
Comments: cDNA was obtained from UMR cDNA Resource Center, www.cdna.org . Also see Dupré et al., 2006 Cell Signal. 2007 Mar;19(3):481-9. https://www.ncbi.nlm.nih.gov/pubmed/16979872 for more information.

Proper citation: RRID:Addgene_46776 Copy   


  • RRID:Addgene_46777

    This resource has 1+ mentions.

http://www.addgene.org/46777

Species: Homo sapiens
Genetic Insert: Rab1a S25N mutant
Vector Backbone Description: Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16959776
Comments: cDNA was obtained from UMR cDNA Resource Center, www.cdna.org To make mutation, the following primers were used for PCR amplification: Rab1 S25N FWD (5′-AGCTCGGATCCACCATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGACTCAGGGGTTGGAAAGAATTGCCTTCTTCT-3′) BGH RVS primer (5′-TAGAAGGCACAGTCGAGG-3′)

Proper citation: RRID:Addgene_46777 Copy   


  • RRID:Addgene_46770

    This resource has 1+ mentions.

http://www.addgene.org/46770

Species: Rattus norvegicus
Genetic Insert: GAL4(1-147)-CREB-S133A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNAI-AMP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7958915

Proper citation: RRID:Addgene_46770 Copy   


  • RRID:Addgene_46769

    This resource has 1+ mentions.

http://www.addgene.org/46769

Species: Rattus norvegicus
Genetic Insert: GAL4(1-147)-CREB
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNAI-AMP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7958915

Proper citation: RRID:Addgene_46769 Copy   


  • RRID:Addgene_46759

    This resource has 50+ mentions.

http://www.addgene.org/46759

Species: Synthetic
Genetic Insert: gRNA core
Vector Backbone Description: Backbone Size:2400; Vector Backbone:pUC19; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23918387
Comments: For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/

Proper citation: RRID:Addgene_46759 Copy   


  • RRID:Addgene_46753

    This resource has 1+ mentions.

http://www.addgene.org/46753

Species: Homo sapiens
Genetic Insert: USP7
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20601937
Comments: Sequence discrepancies between the full and QC sequences have no functional consequence.

Proper citation: RRID:Addgene_46753 Copy   


  • RRID:Addgene_46750

    This resource has 1+ mentions.

http://www.addgene.org/46750

Species: Homo sapiens
Genetic Insert: USP11
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20601937

Proper citation: RRID:Addgene_46750 Copy   


  • RRID:Addgene_46751

    This resource has 1+ mentions.

http://www.addgene.org/46751

Species: Homo sapiens
Genetic Insert: USP7
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20601937
Comments: Sequence discrepancies between the full and QC sequences have no functional consequence.

Proper citation: RRID:Addgene_46751 Copy   


  • RRID:Addgene_46757

    This resource has 100+ mentions.

http://www.addgene.org/46757

Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:2800; Vector Backbone:pT3T7; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23918387
Comments: For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/

Proper citation: RRID:Addgene_46757 Copy   


  • RRID:Addgene_46754

    This resource has 1+ mentions.

http://www.addgene.org/46754

Species: Homo sapiens
Genetic Insert: USP7
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20601937
Comments: Sequence discrepancies between the full and QC sequences have no functional consequence.

Proper citation: RRID:Addgene_46754 Copy   


  • RRID:Addgene_46747

    This resource has 1+ mentions.

http://www.addgene.org/46747

Genetic Insert: USP11
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20601937

Proper citation: RRID:Addgene_46747 Copy   


  • RRID:Addgene_46748

    This resource has 1+ mentions.

http://www.addgene.org/46748

Species: Homo sapiens
Genetic Insert: USP11
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20601937

Proper citation: RRID:Addgene_46748 Copy   


http://www.addgene.org/46742

Species: Caenorhabditis elegans
Genetic Insert: cel-mir-240
Vector Backbone Description: Backbone Marker:Bartel lab; Backbone Size:5179; Vector Backbone:pMT-DEST48 mir-1-1 reporter; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23415231

Proper citation: RRID:Addgene_46742 Copy   


http://www.addgene.org/46863

Species: Mus musculus
Genetic Insert: IL-17RA-delta-SEFIR
Vector Backbone Description: Backbone Size:5750; Vector Backbone:pCMV4-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17456598

Proper citation: RRID:Addgene_46863 Copy   


http://www.addgene.org/46740

Species: Caenorhabditis elegans
Genetic Insert: cel-mir-50
Vector Backbone Description: Backbone Marker:Bartel lab; Backbone Size:5179; Vector Backbone:pMT-DEST48 mir-1-1 reporter; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23415231

Proper citation: RRID:Addgene_46740 Copy   


http://www.addgene.org/46861

Species: Mus musculus
Genetic Insert: IL-17RA-CFP
Vector Backbone Description: Backbone Size:6473; Vector Backbone:pCMV4-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17456598

Proper citation: RRID:Addgene_46861 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X