Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

328,630 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pCEV-G1-Ph
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46814 Ampicillin PMID:24161108 Vector Backbone:pSP-G1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 3
pCEV-G4-Km
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46819 Ampicillin PMID:24161108 Vector Backbone:pCEV-G2-Km; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 4
BDD FVIII H4
 
Resource Report
Resource Website
RRID:Addgene_46774 B-domain deleted FVIII H4 (R484H) Homo sapiens Ampicillin Polymorphisms described in: Inhibitors of factor VIII in black patients with hemophilia. Viel KR, Ameri A, Abshire TC, Iyer RV, Watts RG, Lutcher C, Channell C, Cole SA, Fernstrom KM, Nakaya S, Kasper CK, Thompson AR, Almasy L, Howard TE. N Engl J Med. 2009 Apr 16;360(16):1618-27. doi: 10.1056/NEJMoa075760. Erratum in: N Engl J Med. 2009 Jul 30;361(5):544. PMID:1936966 Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin R484H 2026-08-15 01:15:35 0
FVIII H2
 
Resource Report
Resource Website
RRID:Addgene_46773 full length FVIII D1241E Homo sapiens Ampicillin Polymorphisms described in: Inhibitors of factor VIII in black patients with hemophilia. Viel KR, Ameri A, Abshire TC, Iyer RV, Watts RG, Lutcher C, Channell C, Cole SA, Fernstrom KM, Nakaya S, Kasper CK, Thompson AR, Almasy L, Howard TE. N Engl J Med. 2009 Apr 16;360(16):1618-27. doi: 10.1056/NEJMoa075760. Erratum in: N Engl J Med. 2009 Jul 30;361(5):544. PMID:1936966 Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin D1241E 2026-08-15 01:15:35 0
PCMV-intron myc Rab1aWT
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46776 Rab1a Homo sapiens Ampicillin PMID:16959776 cDNA was obtained from UMR cDNA Resource Center, www.cdna.org . Also see Dupré et al., 2006 Cell Signal. 2007 Mar;19(3):481-9. https://www.ncbi.nlm.nih.gov/pubmed/16979872 for more information. Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 4
PCMV-intron myc Rab1a S25N
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46777 Rab1a S25N mutant Homo sapiens Ampicillin PMID:16959776 cDNA was obtained from UMR cDNA Resource Center, www.cdna.org To make mutation, the following primers were used for PCR amplification: Rab1 S25N FWD (5′-AGCTCGGATCCACCATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGACTCAGGGGTTGGAAAGAATTGCCTTCTTCT-3′) BGH RVS primer (5′-TAGAAGGCACAGTCGAGG-3′) Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S25N (dominant negative) 2026-08-15 01:15:35 2
pcDNAI-GAL4-CREB-S133A
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46770 GAL4(1-147)-CREB-S133A Rattus norvegicus Ampicillin PMID:7958915 Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNAI-AMP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Changed CREB serine 133 to Alanine 2026-08-15 01:15:35 1
pcDNAI-GAL4-CREB
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46769 GAL4(1-147)-CREB Rattus norvegicus Ampicillin PMID:7958915 Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNAI-AMP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 1
pT7-gRNA
 
Resource Report
Resource Website
50+ mentions
RRID:Addgene_46759 gRNA core Synthetic Ampicillin PMID:23918387 For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ Backbone Size:2400; Vector Backbone:pUC19; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 68
pQHA-USP7 WT puroR
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46753 USP7 Homo sapiens Ampicillin PMID:20601937 Sequence discrepancies between the full and QC sequences have no functional consequence. Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 5
pQHA-USP11 CS puroR
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46750 USP11 Homo sapiens Ampicillin PMID:20601937 Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin C318S--catalytically inactive 2026-08-15 01:15:35 3
pQFlag-USP7 WT puroR
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46751 USP7 Homo sapiens Ampicillin PMID:20601937 Sequence discrepancies between the full and QC sequences have no functional consequence. Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 4
pT3TS-nCas9n
 
Resource Report
Resource Website
100+ mentions
RRID:Addgene_46757 Cas9 Synthetic Ampicillin PMID:23918387 For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ Backbone Size:2800; Vector Backbone:pT3T7; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 131
pQHA-USP7 CS puroR
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46754 USP7 Homo sapiens Ampicillin PMID:20601937 Sequence discrepancies between the full and QC sequences have no functional consequence. Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin C223S--catalytically inactive 2026-08-15 01:15:35 2
pQFlag-USP11 WT puroR
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46747 USP11 Ampicillin PMID:20601937 Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 1
pQFlag-USP11 CS puroR
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46748 USP11 Homo sapiens Ampicillin PMID:20601937 Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin C318S--catalytically inactive 2026-08-15 01:15:35 1
pMT mir-1-1 reporter cel-mir-240
 
Resource Report
Resource Website
RRID:Addgene_46742 cel-mir-240 Caenorhabditis elegans Ampicillin PMID:23415231 Backbone Marker:Bartel lab; Backbone Size:5179; Vector Backbone:pMT-DEST48 mir-1-1 reporter; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 0
pCMV4Neo-murine IL-17RASEFIR-HA
 
Resource Report
Resource Website
RRID:Addgene_46863 IL-17RA-delta-SEFIR Mus musculus Ampicillin PMID:17456598 Backbone Size:5750; Vector Backbone:pCMV4-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Deletion of SEFIR domain (AA 394-485) 2026-08-15 01:15:36 0
pMT mir-1-1 reporter cel-mir-50
 
Resource Report
Resource Website
RRID:Addgene_46740 cel-mir-50 Caenorhabditis elegans Ampicillin PMID:23415231 Backbone Marker:Bartel lab; Backbone Size:5179; Vector Backbone:pMT-DEST48 mir-1-1 reporter; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 0
pCMV4-Flag-mIL-17RA/CFP.Hygro
 
Resource Report
Resource Website
RRID:Addgene_46861 IL-17RA-CFP Mus musculus Ampicillin PMID:17456598 Backbone Size:6473; Vector Backbone:pCMV4-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.