Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:synthetic (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

30,421 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
GGE132
 
Resource Report
Resource Website 		RRID:Addgene_120745 P1_EYK300-4AB Synthetic Kanamycin PMID:31148366 Vector Backbone:pUC; Vector Types:Cloning/assembly plasmid; Bacterial Resistance:Kanamycin 2026-08-15 01:03:26 0
GGE250
 
Resource Report
Resource Website 		RRID:Addgene_120746 P1_EYK300-5AB Synthetic Kanamycin PMID:31148366 Vector Backbone:pCR4Blunt-TOPO; Vector Types:Cloning/assembly plasmid; Bacterial Resistance:Kanamycin 2026-08-15 01:03:26 0
GGE368
 
Resource Report
Resource Website 		RRID:Addgene_120737 Marker_Nat Synthetic Kanamycin PMID:31148366 Vector Backbone:pCR4Blunt-TOPO; Vector Types:Cloning/assembly plasmid; Bacterial Resistance:Kanamycin 2026-08-15 01:03:26 0
GGE270
 
Resource Report
Resource Website 		RRID:Addgene_120780 G1_YFP Synthetic Kanamycin PMID:31148366 Vector Backbone:pCR4Blunt-TOPO; Vector Types:Cloning/assembly plasmid; Bacterial Resistance:Kanamycin 2026-08-15 01:03:27 0
GGE261
 
Resource Report
Resource Website 		RRID:Addgene_120783 G3_mTurquoise Synthetic Kanamycin PMID:31148366 Vector Backbone:pCR4Blunt-TOPO; Vector Types:Cloning/assembly plasmid; Bacterial Resistance:Kanamycin 2026-08-15 01:03:27 0
pDSW1728
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_120812 red fluorescent protein (mCherry), codon-optimized for C. difficile Synthetic Chloramphenicol PMID:25527559 Backbone Size:6400; Vector Backbone:pRFP185; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:03:27 1
pRAN473
 
Resource Report
Resource Website 		RRID:Addgene_120813 red fluorescent protein (mCherry), codon-optimized for C. difficile, multiple-cloning site for protein fusion Synthetic Chloramphenicol PMID:25527559 Backbone Size:6400; Vector Backbone:pRFP185; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:03:27 0
pRAN334
 
Resource Report
Resource Website 		RRID:Addgene_120814 cyan fluorescent protein, codon-optimized for low GC organisms Synthetic Chloramphenicol PMID:24727226 Backbone Size:6400; Vector Backbone:pRFP185; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:03:30 0
pAAV-hsyn_NES-His-rsCaMPARI-mRuby3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_120805 rsCaMPARI Synthetic Ampicillin PMID:32931424 Backbone Size:4270; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:03:27 1
pACYC-Cas12g1-noncoding
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_120880 Noncoding sequences for CRISPR-Cas12g1 Synthetic Chloramphenicol PMID:30523077 For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at [email protected]. Backbone Marker:ATCC; Backbone Size:4327; Vector Backbone:pACYC184; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol 2026-08-15 01:03:28 1
pET28a-mH6-Cas12i1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_120882 Cas12i1 Synthetic Kanamycin PMID:30523077 For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at [email protected]. mH6 sequence: ATGAAAATCGAAGAAGGTAAAGGTCACCATCACCATCACCAC Backbone Marker:Novagen; Backbone Size:5349; Vector Backbone:pET-28a+; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin WT 2026-08-15 01:03:30 3
GalT-moxMaple3
 
Resource Report
Resource Website 		RRID:Addgene_120884 moxMaple3 Synthetic Kanamycin PMID:30283009 Vector Backbone:pEGFP based; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:03:28 0
ER-moxMaple3
 
Resource Report
Resource Website 		RRID:Addgene_120885 moxMaple3 Synthetic Kanamycin PMID:30283009 Please Note: Plasmid contains a 72 basepair deletion in the SV40 promoter sequence upstream of NeoR/KanR compared to the ER-mRFP vector backbone. This deletion is not known to affect plasmid function. Backbone Marker:Addgene plasmid 62236; Vector Backbone:ER-mRFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:03:30 0
PB-fLuc=tdT
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_120870 pcDNA3-fLuc=tdT Synthetic Ampicillin PMID:34650390 Backbone Size:5297; Vector Backbone:PB-CAG-eGFPd2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:03:30 1
pBAD/HisD-moxMaple3
 
Resource Report
Resource Website 		RRID:Addgene_120871 moxMaple3 Synthetic Ampicillin PMID:30283009 Vector Backbone:pBAD/His-D; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin from mMaple3, moxMaple3 was engineered by replacing Cysteines 110 and 180 with Alanines or Valines, and the consensus N-linked Asparagines with Glutamine and Aspartic acid 2026-08-15 01:03:28 0
pET28a-mH6-Cas12c2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_120873 Cas12c2 Synthetic Kanamycin PMID:30523077 For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at [email protected]. mH6 sequence: ATGAAAATCGAAGAAGGTAAAGGTCACCATCACCATCACCAC Backbone Marker:Novagen; Backbone Size:5355; Vector Backbone:pET-28a+; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:03:30 3
pMT-P3
 
Resource Report
Resource Website 		RRID:Addgene_120865 Permuteposon P3 Synthetic Kanamycin PMID:31128779 For detailed annotations of the modified R1R2 and R2R1 sites see the Genbank file under Resource Information/Supplemental Documents. Vector Backbone:ColE1; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:03:30 0
pMT-P4
 
Resource Report
Resource Website 		RRID:Addgene_120866 Permuteposon P4 Synthetic Kanamycin PMID:31128779 For detailed annotations of the modified R1R2 and R2R1 sites see the Genbank file under Resource Information/Supplemental Documents. Vector Backbone:ColE1; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:03:28 0
PB-Aka-P2A-GFP
 
Resource Report
Resource Website 		RRID:Addgene_120867 Akaluc Synthetic Ampicillin PMID:34650390 Backbone Marker:pCAGGFP; Backbone Size:6310; Vector Backbone:PB-CAG-eGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin insert Akaluc and a P2A site 2026-08-15 01:03:28 0
PB-Antares2
 
Resource Report
Resource Website 		RRID:Addgene_120868 pcDNA3-Antares2 Synthetic Ampicillin PMID:34650390 Backbone Marker:SynBio-Tech; Backbone Size:5290; Vector Backbone:PB-CAG-eGFPd2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Antares2 amplicon 2026-08-15 01:03:30 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch