Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 161 showing 3201 ~ 3220 out of 328,630 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_46746

    This resource has 10+ mentions.

http://www.addgene.org/46746

Species: Homo sapiens
Genetic Insert: KRAS*G12V
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23246410

Proper citation: RRID:Addgene_46746 Copy   


http://www.addgene.org/46867

Species: Mus musculus
Genetic Insert: 24p3/lipocalin 2 proximal promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17456598

Proper citation: RRID:Addgene_46867 Copy   


http://www.addgene.org/46743

Species: Homo sapiens
Genetic Insert: hsa-mir-128-1
Vector Backbone Description: Backbone Marker:Bartel lab; Backbone Size:5179; Vector Backbone:pMT-DEST48 mir-1-1 reporter; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23415231

Proper citation: RRID:Addgene_46743 Copy   


http://www.addgene.org/46865

Species: Mus musculus
Genetic Insert: 24p3/lipocalin 2 proximal promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17456598

Proper citation: RRID:Addgene_46865 Copy   


  • RRID:Addgene_47028

    This resource has 1+ mentions.

http://www.addgene.org/47028

Species: Mus musculus
Genetic Insert: Brn4
Vector Backbone Description: Backbone Size:5871; Vector Backbone:pMX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22445517

Proper citation: RRID:Addgene_47028 Copy   


  • RRID:Addgene_46971

    This resource has 10+ mentions.

http://www.addgene.org/46971

Species: Homo sapiens
Genetic Insert: Bcl2
Vector Backbone Description: Backbone Marker:System Biosciences; Vector Backbone:PCDH-CMV-MCS-EF1-PURO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23403638
Comments: Bcl-2 was cut from 3544 pMIG Bcl-2 (Addgene #8793) and subcloned into the EcoRI sites of pCDH-CMV-MCS-EF1-Puro.

Proper citation: RRID:Addgene_46971 Copy   


  • RRID:Addgene_47023

    This resource has 1+ mentions.

http://www.addgene.org/47023

Species: Mus musculus
Genetic Insert: Mu L1+L2
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22985477

Proper citation: RRID:Addgene_47023 Copy   


  • RRID:Addgene_46961

    This resource has 1+ mentions.

http://www.addgene.org/46961

Species: Homo sapiens
Genetic Insert: human Ku70
Vector Backbone Description: Backbone Size:5044; Vector Backbone:pICE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23897892

Proper citation: RRID:Addgene_46961 Copy   


  • RRID:Addgene_46963

    This resource has 1+ mentions.

http://www.addgene.org/46963

Species: Physarum polycephalum
Genetic Insert: NLS-I-PpoI
Vector Backbone Description: Backbone Size:5044; Vector Backbone:pICE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23897892

Proper citation: RRID:Addgene_46963 Copy   


  • RRID:Addgene_46950

    This resource has 1+ mentions.

http://www.addgene.org/46950

Species: Homo sapiens
Genetic Insert: HPV52L1+L2
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18360909

Proper citation: RRID:Addgene_46950 Copy   


  • RRID:Addgene_46945

http://www.addgene.org/46945

Species: Homo sapiens
Genetic Insert: Ap1g1-FKBP
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pIRESneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20159602

Proper citation: RRID:Addgene_46945 Copy   


  • RRID:Addgene_46949

    This resource has 1+ mentions.

http://www.addgene.org/46949

Species: Aequorea victoria
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCIneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18228512

Proper citation: RRID:Addgene_46949 Copy   


  • RRID:Addgene_46944

    This resource has 1+ mentions.

http://www.addgene.org/46944

Species: Homo sapiens
Genetic Insert: Ap2a2-FKBP
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pIRESneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20159602

Proper citation: RRID:Addgene_46944 Copy   


http://www.addgene.org/46941

Genetic Insert: 5' iRFP arm
Vector Backbone Description: Backbone Size:5065; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Bacterial Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24121685

Proper citation: RRID:Addgene_46941 Copy   


  • RRID:Addgene_47

    This resource has 1+ mentions.

http://www.addgene.org/47

Species: Mus musculus
Genetic Insert: PGC-1a
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1 myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14744933
Comments: Please see Addgene plasmid 1026 (pcDNA-f:PGC1) for wildtype sequence and map.

Proper citation: RRID:Addgene_47 Copy   


  • RRID:Addgene_46936

http://www.addgene.org/46936

Species: P. haloplanktis
Genetic Insert: PheS Gly294
Vector Backbone Description: Backbone Marker:Open Biosystems; Backbone Size:11688; Vector Backbone:GIPZ; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21307310

Proper citation: RRID:Addgene_46936 Copy   


  • RRID:Addgene_46893

http://www.addgene.org/46893

Species: Homo sapiens
Genetic Insert: SH3BP4 W92A
Vector Backbone Description: Backbone Marker:clonetch; Vector Backbone:pRK5-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22575674
Comments: Mutagenesis was performed using a site-directed mutagenesis kit (Stratagene) and the following primer: cacatctggcggtgaggcgtggtacgcacacaac

Proper citation: RRID:Addgene_46893 Copy   


  • RRID:Addgene_46932

http://www.addgene.org/46932

Species: Homo sapiens
Genetic Insert: FJX1
Vector Backbone Description: Backbone Size:12800; Vector Backbone:LZRS-MS-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_46932 Copy   


  • RRID:Addgene_46930

http://www.addgene.org/46930

Species: Homo sapiens
Genetic Insert: FJX1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5015; Vector Backbone:pcDNA3.1/Zeo(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_46930 Copy   


  • RRID:Addgene_46926

    This resource has 10+ mentions.

http://www.addgene.org/46926

Species: Homo sapiens
Genetic Insert: 5X HRE of VEGF
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pEF/myc/cyto; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11774035
Comments: The 35-bp human VEGF HRE sequence is: CCACAGTGCATACGTGGGCTCCAACAGGTCCTCTT The d2EGFP fragment was amplified from a Clontech (Palo Alto, CA) vector and encodes a destabilized red- shifted variant of wild-type GFP with an excitation maximum of 488 nm, an emission maximum of 507 nm, and a half-life of approximately 2 hours.

Proper citation: RRID:Addgene_46926 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X