Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: VPS9
Vector Backbone Description: Vector Backbone:YCplac111; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12628920
Comments: To insert an HA epitope at the N-terminus of Vps9, a NotI site was introduced after the first methionine codon of VPS9 in pPS91 (Hama et al., 1999). NotI-VPS9 was then subcloned into the centromere-based vector YCplac111 and a fragment encoding an 3xHA tag flanked by NotI sites was inserted.
Proper citation: RRID:Addgene_32431 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 20XUAS
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2560; Vector Backbone:pDONR 221 P1-P4; Vector Types:Gateway MultiSite entry clone; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21931740
Comments: Please see http://www.everyvector.com/sequences/show_public/12858 for additional plasmid map.
Proper citation: RRID:Addgene_32307 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GAL4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2557; Vector Backbone:pDONR 221 P5-P2; Vector Types:Gateway MultiSite entry clone; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21931740
Comments: Please see http://www.everyvector.com/sequences/show_public/12863 for additional plasmid map.
Proper citation: RRID:Addgene_32304 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ENT2
Vector Backbone Description: Backbone Marker:ATCC; Vector Backbone:YCplac22; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_32429 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: UBC4
Vector Backbone Description: Backbone Marker:ATCC; Vector Backbone:YCplac22; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_32440 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: LEU2MX6
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24215641
Proper citation: RRID:Addgene_33138 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: The PLint sequence was derived from the short version (delta2) of the RP51A intron (Pikielny et al., 1983). The basic strategy was to make a short intron of about 60 nucleotides, keeping as much as possible of the sequence near the consensus sequences, and adding convenient restriction sites.
Inserted sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG
Proper citation: RRID:Addgene_33145 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TRP1
Vector Backbone Description: Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25998947
Comments: This is the improved version of Plasmid 69196
Proper citation: RRID:Addgene_69503 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: mCitrine minus start and stop codon
Vector Backbone Description: Backbone Size:4000; Vector Backbone:POM43; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26727004
Proper citation: RRID:Addgene_69855 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: YDL183c
Vector Backbone Description: Backbone Size:6231; Vector Backbone:pUG35; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20197279
Proper citation: RRID:Addgene_70161 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 10X-tRNA block
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4762; Vector Backbone:pDONR221; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29212664
Comments: The depositing lab notes that, despite the differences found in Addgene's QC sequence, this plasmid should work as advertised.
Proper citation: RRID:Addgene_70123 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: DASH / Dam1 complex
Vector Backbone Description: Vector Backbone:pST39; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15640796
Proper citation: RRID:Addgene_70699 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Osh2-PH
Vector Backbone Description: Backbone Marker:Amersham-Pharmacia; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15023338
Proper citation: RRID:Addgene_71370 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Skm1-PH
Vector Backbone Description: Backbone Marker:Amersham-Pharmacia; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15023338
Proper citation: RRID:Addgene_71371 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Num1-PH
Vector Backbone Description: Backbone Marker:Amersham-Pharmacia; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15023338
Proper citation: RRID:Addgene_71369 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: NME1
Vector Backbone Description: Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8247008
Comments: CEN, LEU2 based plasmid with NME1 gene region sufficient for NME1 expression in yeast where NME1 gene is disrupted.
Proper citation: RRID:Addgene_71849 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:5718; Vector Backbone:pRSII426; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26305040
Proper citation: RRID:Addgene_67638 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: single guide RNA expression cassette
Vector Backbone Description: Backbone Size:4749; Vector Backbone:pCT3; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26305040
Proper citation: RRID:Addgene_67640 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Atg9-EGFP
Vector Backbone Description: Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25998947
Proper citation: RRID:Addgene_69164 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Atg6-EGFP
Vector Backbone Description: Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25998947
Proper citation: RRID:Addgene_69163 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
