Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: sgRNA targeting endogenous TRE elements of pTET07 promoter
Vector Backbone Description: Backbone Size:5083; Vector Backbone:AH057; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981
Comments: gRNA target sequence TATCAGTGATAGAGAAAAGT
Proper citation: RRID:Addgene_46923 Copy
Species: Homo sapiens
Genetic Insert: FJX1
Vector Backbone Description: Backbone Size:12800; Vector Backbone:LZRS-MS-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_46929 Copy
Species: Homo sapiens
Genetic Insert: FJX1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5200; Vector Backbone:pIRES-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: A 5' EcoRI site and 3' myc tag were added to the FJX1 cDNA by PCR. The fragment was blunt end ligated into an EcoRV site on pIRES-EGFP so there is an additional EcoRI site at 5' end of FJX1.
Proper citation: RRID:Addgene_46928 Copy
Species: Homo sapiens
Genetic Insert: Uracil-N-glycosylase WT
Vector Backbone Description: Backbone Marker:Homemade; Backbone Size:6686; Vector Backbone:pMA2780; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23721969
Proper citation: RRID:Addgene_46885 Copy
Genetic Insert: dCas9
Vector Backbone Description: Backbone Size:6900; Vector Backbone:pJED103; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981
Comments: The Cas9 contains a N612K mutation that does not effect the function of the enzyme.
Proper citation: RRID:Addgene_46920 Copy
Vector Backbone Description: Backbone Marker:Homemade; Backbone Size:6990; Vector Backbone:pMA3211; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22637478
Proper citation: RRID:Addgene_46880 Copy
Genetic Insert: sgGFP-NT1
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981
Comments: gRNA target sequence GAATAGCTCAGAGGCCGAGG
Proper citation: RRID:Addgene_46914 Copy
Genetic Insert: sgGAL4-1
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981
Comments: gRNA target sequence GTTGGAGCACTGTCCTCCGAACGT
Proper citation: RRID:Addgene_46915 Copy
Vector Backbone Description: Backbone Marker:Homemade; Backbone Size:6642; Vector Backbone:pMA3211; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22637478
Proper citation: RRID:Addgene_46879 Copy
Species: Homo sapiens
Genetic Insert: dCas9-p65AD-BFP fusion
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:MSCV-puro; Vector Types:Mammalian Expression, Retroviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981
Proper citation: RRID:Addgene_46913 Copy
Species: Homo sapiens
Genetic Insert: sgCD71 -2
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981
Comments: gRNA target sequence GGACGCGCTAGTGTGAGTGC
Proper citation: RRID:Addgene_46918 Copy
Genetic Insert: sgGAL4-4
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981
Comments: gRNA target sequence GAACGACTAGTTAGGCGTGTA
Proper citation: RRID:Addgene_46916 Copy
Species: Mus musculus
Genetic Insert: becn1
Vector Backbone Description: Vector Backbone:pqcxih; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23685627
Proper citation: RRID:Addgene_46994 Copy
Species: Rattus norvegicus
Genetic Insert: soluble guanylate cyclase 1alpha3
Vector Backbone Description: Backbone Marker:Homemade; Backbone Size:6642; Vector Backbone:pMA3211; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22637478
Comments: Please note that though there are some differences between Addgene's quality control sequence and the depositor's assembled sequence, this plasmid should function as reported.
Proper citation: RRID:Addgene_46874 Copy
Species: Mus musculus
Genetic Insert: becn1
Vector Backbone Description: Vector Backbone:pqcxih; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23685627
Proper citation: RRID:Addgene_46995 Copy
Species: Drosophila melanogaster
Genetic Insert: Lis1
Vector Backbone Description: Vector Backbone:CS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23097494
Proper citation: RRID:Addgene_47047 Copy
Species: Rattus norvegicus
Genetic Insert: soluble guanylate cyclase1 beta 3
Vector Backbone Description: Backbone Size:5684; Vector Backbone:pMA1662; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22637478
Proper citation: RRID:Addgene_46877 Copy
Species: Drosophila melanogaster
Genetic Insert: Asunder
Vector Backbone Description: Vector Backbone:CS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23097494
Proper citation: RRID:Addgene_47041 Copy
Species: Drosophila melanogaster
Genetic Insert: Lis1
Vector Backbone Description: Vector Backbone:CS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23097494
Proper citation: RRID:Addgene_47045 Copy
Species: Mus musculus
Genetic Insert: Asunder
Vector Backbone Description: Vector Backbone:CS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23097494
Proper citation: RRID:Addgene_47044 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
