Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

328,630 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pSNR52-sgTET
 
Resource Report
Resource Website 		RRID:Addgene_46923 sgRNA targeting endogenous TRE elements of pTET07 promoter Saccharomyces cerevisiae Ampicillin PMID:23849981 gRNA target sequence TATCAGTGATAGAGAAAAGT Backbone Size:5083; Vector Backbone:AH057; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
LZRSMS-GFP-hFJX1-Flag
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46929 FJX1 Homo sapiens Ampicillin Backbone Size:12800; Vector Backbone:LZRS-MS-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 1
pIRES-GFP-hFJX1-myc
 
Resource Report
Resource Website 		RRID:Addgene_46928 FJX1 Homo sapiens Ampicillin A 5' EcoRI site and 3' myc tag were added to the FJX1 cDNA by PCR. The fragment was blunt end ligated into an EcoRV site on pIRES-EGFP so there is an additional EcoRI site at 5' end of FJX1. Backbone Marker:Clontech; Backbone Size:5200; Vector Backbone:pIRES-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
pMA3288
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46885 Uracil-N-glycosylase WT Homo sapiens Ampicillin PMID:23721969 Backbone Marker:Homemade; Backbone Size:6686; Vector Backbone:pMA2780; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 1
pTDH3-dCas9
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46920 dCas9 Ampicillin PMID:23849981 The Cas9 contains a N612K mutation that does not effect the function of the enzyme. Backbone Size:6900; Vector Backbone:pJED103; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 7
pMA3174
 
Resource Report
Resource Website 		RRID:Addgene_46880 Ampicillin PMID:22637478 Backbone Marker:Homemade; Backbone Size:6990; Vector Backbone:pMA3211; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
pU6-sgGFP-NT1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46914 sgGFP-NT1 Ampicillin PMID:23849981 gRNA target sequence GAATAGCTCAGAGGCCGAGG Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 8
pU6-sgGAL4-1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46915 sgGAL4-1 Ampicillin PMID:23849981 gRNA target sequence GTTGGAGCACTGTCCTCCGAACGT Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 2
pMA3211
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46879 Ampicillin PMID:22637478 Backbone Marker:Homemade; Backbone Size:6642; Vector Backbone:pMA3211; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 1
pMSCV-LTR-dCas9-p65AD-BFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46913 dCas9-p65AD-BFP fusion Homo sapiens Ampicillin PMID:23849981 Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:MSCV-puro; Vector Types:Mammalian Expression, Retroviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 2
pU6-sgCD71-2
 
Resource Report
Resource Website 		RRID:Addgene_46918 sgCD71 -2 Homo sapiens Ampicillin PMID:23849981 gRNA target sequence GGACGCGCTAGTGTGAGTGC Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
pU6-sgGAL4-4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46916 sgGAL4-4 Ampicillin PMID:23849981 gRNA target sequence GAACGACTAGTTAGGCGTGTA Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 1
Beclin-HA S-A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46994 becn1 Mus musculus Ampicillin PMID:23685627 Vector Backbone:pqcxih; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S14A 2026-08-15 01:15:37 1
pMA3379
 
Resource Report
Resource Website 		RRID:Addgene_46874 soluble guanylate cyclase 1alpha3 Rattus norvegicus Ampicillin PMID:22637478 Please note that though there are some differences between Addgene's quality control sequence and the depositor's assembled sequence, this plasmid should function as reported. Backbone Marker:Homemade; Backbone Size:6642; Vector Backbone:pMA3211; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
Beclin-HA S-D
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46995 becn1 Mus musculus Ampicillin PMID:23685627 Vector Backbone:pqcxih; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S14D 2026-08-15 01:15:37 1
CS2-Myc-dLIS1
 
Resource Report
Resource Website 		RRID:Addgene_47047 Lis1 Drosophila melanogaster Ampicillin PMID:23097494 Vector Backbone:CS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 0
pMA3411
 
Resource Report
Resource Website 		RRID:Addgene_46877 soluble guanylate cyclase1 beta 3 Rattus norvegicus Ampicillin PMID:22637478 Backbone Size:5684; Vector Backbone:pMA1662; Vector Types:Retroviral; Bacterial Resistance:Ampicillin E473K, C541D 2026-08-15 01:15:36 0
CS2-HA-dASUN
 
Resource Report
Resource Website 		RRID:Addgene_47041 Asunder Drosophila melanogaster Ampicillin PMID:23097494 Vector Backbone:CS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 0
CS2-CHY-dLIS1
 
Resource Report
Resource Website 		RRID:Addgene_47045 Lis1 Drosophila melanogaster Ampicillin PMID:23097494 Vector Backbone:CS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 0
CS2-Myc-mASUN
 
Resource Report
Resource Website 		RRID:Addgene_47044 Asunder Mus musculus Ampicillin PMID:23097494 Vector Backbone:CS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:38 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch