Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 162 showing 3221 ~ 3240 out of 4,486 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_69181

http://www.addgene.org/69181

Species: Saccharomyces cerevisiae
Genetic Insert: Atg6-2EGFP
Vector Backbone Description: Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25998947

Proper citation: RRID:Addgene_69181 Copy   


  • RRID:Addgene_69177

http://www.addgene.org/69177

Species: Saccharomyces cerevisiae
Genetic Insert: Atg31-EGFP
Vector Backbone Description: Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25998947

Proper citation: RRID:Addgene_69177 Copy   


  • RRID:Addgene_69176

http://www.addgene.org/69176

Species: Saccharomyces cerevisiae
Genetic Insert: Atg29-EGFP
Vector Backbone Description: Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25998947

Proper citation: RRID:Addgene_69176 Copy   


  • RRID:Addgene_69175

http://www.addgene.org/69175

Species: Saccharomyces cerevisiae
Genetic Insert: Atg27-EGFP
Vector Backbone Description: Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25998947

Proper citation: RRID:Addgene_69175 Copy   


  • RRID:Addgene_69171

http://www.addgene.org/69171

Species: Saccharomyces cerevisiae
Genetic Insert: Atg20-EGFP
Vector Backbone Description: Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25998947

Proper citation: RRID:Addgene_69171 Copy   


  • RRID:Addgene_69191

http://www.addgene.org/69191

Species: Saccharomyces cerevisiae
Genetic Insert: Atg24-2EGFP
Vector Backbone Description: Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25998947

Proper citation: RRID:Addgene_69191 Copy   


  • RRID:Addgene_69190

http://www.addgene.org/69190

Species: Saccharomyces cerevisiae
Genetic Insert: Atg23-2EGFP
Vector Backbone Description: Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25998947

Proper citation: RRID:Addgene_69190 Copy   


  • RRID:Addgene_69189

http://www.addgene.org/69189

Species: Saccharomyces cerevisiae
Genetic Insert: Atg21-2EGFP
Vector Backbone Description: Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25998947

Proper citation: RRID:Addgene_69189 Copy   


  • RRID:Addgene_69185

http://www.addgene.org/69185

Species: Saccharomyces cerevisiae
Genetic Insert: Atg14-2EGFP
Vector Backbone Description: Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25998947

Proper citation: RRID:Addgene_69185 Copy   


  • RRID:Addgene_69183

http://www.addgene.org/69183

Species: Saccharomyces cerevisiae
Genetic Insert: Atg11-2EGFP
Vector Backbone Description: Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25998947

Proper citation: RRID:Addgene_69183 Copy   


  • RRID:Addgene_69182

http://www.addgene.org/69182

Species: Saccharomyces cerevisiae
Genetic Insert: Atg9-2EGFP
Vector Backbone Description: Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25998947

Proper citation: RRID:Addgene_69182 Copy   


  • RRID:Addgene_69198

http://www.addgene.org/69198

Species: Saccharomyces cerevisiae
Genetic Insert: MET15
Vector Backbone Description: Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25998947

Proper citation: RRID:Addgene_69198 Copy   


  • RRID:Addgene_69196

http://www.addgene.org/69196

Species: Saccharomyces cerevisiae
Genetic Insert: TRP1
Vector Backbone Description: Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25998947
Comments: Although this is the plasmid described in the associated publication, the depositor notes that it has a low integration efficiency in yeast and Plasmid 69503 should be used. Please note there are a few discrepancies between the QC and full sequence.

Proper citation: RRID:Addgene_69196 Copy   


  • RRID:Addgene_69166

http://www.addgene.org/69166

Species: Saccharomyces cerevisiae
Genetic Insert: Atg13-EGFP
Vector Backbone Description: Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25998947

Proper citation: RRID:Addgene_69166 Copy   


  • RRID:Addgene_69169

http://www.addgene.org/69169

Species: Saccharomyces cerevisiae
Genetic Insert: Atg17-EGFP
Vector Backbone Description: Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25998947

Proper citation: RRID:Addgene_69169 Copy   


  • RRID:Addgene_69168

http://www.addgene.org/69168

Species: Saccharomyces cerevisiae
Genetic Insert: Atg16-GFP
Vector Backbone Description: Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25998947

Proper citation: RRID:Addgene_69168 Copy   


  • RRID:Addgene_72871

http://www.addgene.org/72871

Species: Saccharomyces cerevisiae
Genetic Insert: FLP recombinase
Vector Backbone Description: Backbone Size:10090; Vector Backbone:pCASPER; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27172193
Comments: this vector is very similar to pMH5 (addgene 52531) but contains an activating point mutation (P2->S) and an additional N-terminal NLS

Proper citation: RRID:Addgene_72871 Copy   


  • RRID:Addgene_72876

    This resource has 10+ mentions.

http://www.addgene.org/72876

Species: Saccharomyces cerevisiae
Genetic Insert: NDI1
Vector Backbone Description: Backbone Size:5639; Vector Backbone:pMXs-IRES-blasticidin; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24670634
Comments: The retroviral NDI1 vector was generated by cloning into the EcoRI and XhoI sites of the pMXS-ires-blast vector a cDNA insert generated by PCR using the primers below, followed by standard cloning techniques. Ndi1 EcoRI F: ATGAATTCCATCACATCATCGAATTAC Ndi1 XhoI R: ATCTCGAGAAAAGGGCATGTTAATTTCATCTATAAT It is a retroviral plasmid so it may be recommended to be propagated at 30oc but author typically grows it at 37oC.

Proper citation: RRID:Addgene_72876 Copy   


  • RRID:Addgene_73046

http://www.addgene.org/73046

Species: Saccharomyces cerevisiae
Genetic Insert: CUS2p
Vector Backbone Description: Backbone Marker:Midwest Center for Structural Genomics; Backbone Size:5704; Vector Backbone:p11; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26631165

Proper citation: RRID:Addgene_73046 Copy   


  • RRID:Addgene_73059

http://www.addgene.org/73059

Species: Saccharomyces cerevisiae
Genetic Insert: CUS2p
Vector Backbone Description: Backbone Marker:Midwest Center for Structural Genomics; Backbone Size:5704; Vector Backbone:p11; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26631165

Proper citation: RRID:Addgene_73059 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X