Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:saccharomyces cerevisiae (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

4,486 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
LD206
 
Resource Report
Resource Website 		RRID:Addgene_69181 Atg6-2EGFP Saccharomyces cerevisiae Ampicillin PMID:25998947 Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:56 0
LD131
 
Resource Report
Resource Website 		RRID:Addgene_69177 Atg31-EGFP Saccharomyces cerevisiae Ampicillin PMID:25998947 Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:50 0
LD129
 
Resource Report
Resource Website 		RRID:Addgene_69176 Atg29-EGFP Saccharomyces cerevisiae Ampicillin PMID:25998947 Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:50 0
LD127
 
Resource Report
Resource Website 		RRID:Addgene_69175 Atg27-EGFP Saccharomyces cerevisiae Ampicillin PMID:25998947 Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:56 0
LD120
 
Resource Report
Resource Website 		RRID:Addgene_69171 Atg20-EGFP Saccharomyces cerevisiae Ampicillin PMID:25998947 Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:50 0
LD224
 
Resource Report
Resource Website 		RRID:Addgene_69191 Atg24-2EGFP Saccharomyces cerevisiae Ampicillin PMID:25998947 Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:50 0
LD223
 
Resource Report
Resource Website 		RRID:Addgene_69190 Atg23-2EGFP Saccharomyces cerevisiae Ampicillin PMID:25998947 Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:56 0
LD221
 
Resource Report
Resource Website 		RRID:Addgene_69189 Atg21-2EGFP Saccharomyces cerevisiae Ampicillin PMID:25998947 Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:50 0
LD214
 
Resource Report
Resource Website 		RRID:Addgene_69185 Atg14-2EGFP Saccharomyces cerevisiae Ampicillin PMID:25998947 Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:50 0
LD211
 
Resource Report
Resource Website 		RRID:Addgene_69183 Atg11-2EGFP Saccharomyces cerevisiae Ampicillin PMID:25998947 Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:50 0
LD209
 
Resource Report
Resource Website 		RRID:Addgene_69182 Atg9-2EGFP Saccharomyces cerevisiae Ampicillin PMID:25998947 Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:50 0
BS-Met15
 
Resource Report
Resource Website 		RRID:Addgene_69198 MET15 Saccharomyces cerevisiae Ampicillin PMID:25998947 Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:50 0
BS-Trp1
 
Resource Report
Resource Website 		RRID:Addgene_69196 TRP1 Saccharomyces cerevisiae Ampicillin PMID:25998947 Although this is the plasmid described in the associated publication, the depositor notes that it has a low integration efficiency in yeast and Plasmid 69503 should be used. Please note there are a few discrepancies between the QC and full sequence. Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:56 0
LD113
 
Resource Report
Resource Website 		RRID:Addgene_69166 Atg13-EGFP Saccharomyces cerevisiae Ampicillin PMID:25998947 Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:56 0
LD117
 
Resource Report
Resource Website 		RRID:Addgene_69169 Atg17-EGFP Saccharomyces cerevisiae Ampicillin PMID:25998947 Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:56 0
LD116
 
Resource Report
Resource Website 		RRID:Addgene_69168 Atg16-GFP Saccharomyces cerevisiae Ampicillin PMID:25998947 Vector Backbone:Bluescript II SK+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:18:50 0
pKF295
 
Resource Report
Resource Website 		RRID:Addgene_72871 FLP recombinase Saccharomyces cerevisiae Ampicillin PMID:27172193 this vector is very similar to pMH5 (addgene 52531) but contains an activating point mutation (P2->S) and an additional N-terminal NLS Backbone Size:10090; Vector Backbone:pCASPER; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin P2->S, added NLS 2026-08-15 01:19:23 0
PMXS-NDI1
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_72876 NDI1 Saccharomyces cerevisiae Ampicillin PMID:24670634 The retroviral NDI1 vector was generated by cloning into the EcoRI and XhoI sites of the pMXS-ires-blast vector a cDNA insert generated by PCR using the primers below, followed by standard cloning techniques. Ndi1 EcoRI F: ATGAATTCCATCACATCATCGAATTAC Ndi1 XhoI R: ATCTCGAGAAAAGGGCATGTTAATTTCATCTATAAT It is a retroviral plasmid so it may be recommended to be propagated at 30oc but author typically grows it at 37oC. Backbone Size:5639; Vector Backbone:pMXs-IRES-blasticidin; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:19:23 27
wt Cus2p
 
Resource Report
Resource Website 		RRID:Addgene_73046 CUS2p Saccharomyces cerevisiae Ampicillin PMID:26631165 Backbone Marker:Midwest Center for Structural Genomics; Backbone Size:5704; Vector Backbone:p11; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:19:25 0
L284F Cus2p
 
Resource Report
Resource Website 		RRID:Addgene_73059 CUS2p Saccharomyces cerevisiae Ampicillin PMID:26631165 Backbone Marker:Midwest Center for Structural Genomics; Backbone Size:5704; Vector Backbone:p11; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin Leucine 284 to Phenylalanine 2026-08-15 01:19:25 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch