Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pH2B-TagRFP675-N1 Resource Report Resource Website |
RRID:Addgene_44279 | TagRFP675 | Synthetic | Kanamycin | PMID:23677204 | Backbone Marker:Clontech; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | M41Q/F80W/S143N/L147M/S158N/D159Y/N173S | 2026-08-15 01:15:14 | 0 | |
|
pUC-UAS1B4-Leum Resource Report Resource Website |
RRID:Addgene_44312 | UAS1B4-Leum promoter | Yarrowia lipolytica | Ampicillin | PMID:21926196 | Discrepancies between the Addgene QC sequence and the depositor's sequence should not affect plasmid function. | Backbone Size:2623; Vector Backbone:pUC19; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | N/A | 2026-08-15 01:15:14 | 0 |
|
pBAD/HisB-PAiRFP2 Resource Report Resource Website |
RRID:Addgene_44271 | PAiRFP2 | Synthetic | Ampicillin | PMID:23842578 | Backbone Marker:Invitrogen; Backbone Size:4064; Vector Backbone:pBAD/HisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | K69R/R83K/G120D/A123T/M163L/Q168E/R220P/S243N/V244F/G269D/A276V/Y280C/V294A/H303F/H333R/I336L/D349R/M351I/A386V/G409D/L419I/T469S/A487T/E494G | 2026-08-15 01:15:14 | 0 | |
|
K15/pGL3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_44264 | K15 promoter (-4.8) | Mus musculus | Ampicillin | PMID:14708593 | Alternate plasmid name: K15(-4.8)-pGL3 The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were CTGAGCTACCAGCGAGACTCC (K15F1) and TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1), respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGL3-Basic (Promega). The entire K15 promoter-luciferase transgene can be released by digestion with XhoI/SalI. | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Mouse Targeting, Luciferase; Bacterial Resistance:Ampicillin | Contains the murine K15 promoter (-4.8) fragment | 2026-08-15 01:15:13 | 1 |
|
K15-TK/pGL3 Resource Report Resource Website |
RRID:Addgene_44267 | K15 promoter (-4.8) | Mus musculus | Ampicillin | PMID:16288281 | Alternate plasmid name: K15-HSV-TK-pGL3 The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were CTGAGCTACCAGCGAGACTCC (K15F1) and TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1), respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGL3-Basic (Promega) to create plasmid K15(-4.8)-pGL3 (Addgene plasmid #44264). The HSV-1 TK reporter gene cDNA was then excised from a TK/PBSIIKS plasmid, using NotI and SalI, and cloned downstream of the K15 promoter, replacing luciferase. The entire K15 promoter-HSV-TK transgene can be released by digestion with XhoI/SalI. | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Mouse Targeting, Thymidine kinase; Bacterial Resistance:Ampicillin | Contains the murine K15 promoter (-4.8) fragment | 2026-08-15 01:15:14 | 0 |
|
K15-EGFP Resource Report Resource Website |
RRID:Addgene_44266 | K15 promoter (-4.8) | Mus musculus | Kanamycin | PMID:15024388 | Alternate plasmid name: pEGFP-N2 K15 The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were CTGAGCTACCAGCGAGACTCC (K15F1) and TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1), respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGEGFP-N2 The entire K15 promoter-EGFP transgene can be released by digestion with XhoI/AflII. | Backbone Marker:Clontech; Backbone Size:4737; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression, Mouse Targeting, Fluorescence microscopy; Bacterial Resistance:Kanamycin | Contains the murine K15 promoter (-4.8) fragment | 2026-08-15 01:15:14 | 0 |
|
pMH4-Syn1-Ratio1XsypHy Resource Report Resource Website 1+ mentions |
RRID:Addgene_44268 | SypHy1x-tdimer2(12) | Ampicillin | PMID:23522046 | Vector Backbone:pMH4; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:14 | 1 | |||
|
pwtCas9-bacteria Resource Report Resource Website 10+ mentions |
RRID:Addgene_44250 | wild-type Cas9 | S .pyogenes | Ampicillin | PMID:23452860 | Vector Backbone:pUC19; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:13 | 17 | ||
|
pgRNA-bacteria Resource Report Resource Website 50+ mentions |
RRID:Addgene_44251 | guide RNA (bacteria) | Ampicillin | PMID:23452860 | Vector Backbone:pUC19; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:13 | 73 | |||
|
pET-28a-hPKM2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_44242 | Pyruvate Kinase M2 | Homo sapiens | Kanamycin | PMID:18337815 | Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:13 | 5 | ||
|
pdCas9-bacteria Resource Report Resource Website 50+ mentions |
RRID:Addgene_44249 | dCas9 (bacteria) | S. pyogenes | Chloramphenicol | PMID:23452860 | Vector Backbone:p15A vector; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol | D10A H840A (catalytically inactive) | 2026-08-15 01:15:14 | 82 | |
|
pgRNA-humanized Resource Report Resource Website 50+ mentions |
RRID:Addgene_44248 | guide RNA | Homo sapiens | Ampicillin | PMID:23452860 | Vector Backbone:pU6; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:13 | 58 | ||
|
pET-28a-hPKM1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_44241 | Pyruvate Kinase M1 | Homo sapiens | Kanamycin | PMID:18337815 | Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:14 | 7 | ||
|
pLHCX-FLAG-mPKM1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_44240 | Pyruvate Kinase M1 | Mus musculus | Ampicillin | PMID:18337823 | Backbone Marker:Clontech; Backbone Size:6800; Vector Backbone:pLHCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:13 | 2 | ||
|
pLHCX-FLAG-mPKM2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_44239 | Pyruvate Kinase M2 | Mus musculus | Ampicillin | PMID:18337823 | Backbone Marker:Clontech; Backbone Size:6800; Vector Backbone:pLHCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:13 | 5 | ||
|
BC-GPRC Resource Report Resource Website |
RRID:Addgene_44199 | human GPR56 C-terminal fragment | Homo sapiens | Ampicillin | Backbone Marker:unknown; Backbone Size:7500; Vector Backbone:Barcode; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | C-terminal fragment of GPR56 starting at amino acid 383, right after the cleavage site in the GPS motif | 2026-08-15 01:15:13 | 0 | ||
|
pFIN-EF1a-CHER-WPRE Resource Report Resource Website |
RRID:Addgene_44353 | EF1a-CHER | Homo sapiens | Ampicillin | PMID:20517486 | Backbone Marker:LJ Chang; Backbone Size:8760; Vector Backbone:pTY; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:14 | 0 | ||
|
BC-deltaSTP-GPR56 Resource Report Resource Website |
RRID:Addgene_44198 | human deltaSTP-GPR56 | Homo sapiens | Ampicillin | Backbone Marker:unknown; Backbone Size:7500; Vector Backbone:Barcode; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | deletion of amino acids 108 - 177 | 2026-08-15 01:15:14 | 0 | ||
|
pFIN-EF1a-GFP-WPRE Resource Report Resource Website 1+ mentions |
RRID:Addgene_44352 | EF1a-GFP | Homo sapiens | Ampicillin | PMID:20517486 | Backbone Marker:LJ Chang; Backbone Size:8738; Vector Backbone:pTY; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:15 | 1 | ||
|
pRCIscript-crhr1_TAL1A Resource Report Resource Website |
RRID:Addgene_44234 | crhr1 pTAL scaffold 1A | Danio rerio | Ampicillin | PMID:23000899 | Please note that some of the NN RVDs of this TALEN plasmid, which recognize G nucleotides were actually made with NK RVDs (which also recognize G nucleotides). This alters a single amino acid within the RVD | Backbone Marker:Addgene plasmid 38142; Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:mRNA transcription vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:13 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.