Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pH2B-TagRFP675-N1
 
Resource Report
Resource Website
RRID:Addgene_44279 TagRFP675 Synthetic Kanamycin PMID:23677204 Backbone Marker:Clontech; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin M41Q/F80W/S143N/L147M/S158N/D159Y/N173S 2026-08-15 01:15:14 0
pUC-UAS1B4-Leum
 
Resource Report
Resource Website
RRID:Addgene_44312 UAS1B4-Leum promoter Yarrowia lipolytica Ampicillin PMID:21926196 Discrepancies between the Addgene QC sequence and the depositor's sequence should not affect plasmid function. Backbone Size:2623; Vector Backbone:pUC19; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin N/A 2026-08-15 01:15:14 0
pBAD/HisB-PAiRFP2
 
Resource Report
Resource Website
RRID:Addgene_44271 PAiRFP2 Synthetic Ampicillin PMID:23842578 Backbone Marker:Invitrogen; Backbone Size:4064; Vector Backbone:pBAD/HisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin K69R/R83K/G120D/A123T/M163L/Q168E/R220P/S243N/V244F/G269D/A276V/Y280C/V294A/H303F/H333R/I336L/D349R/M351I/A386V/G409D/L419I/T469S/A487T/E494G 2026-08-15 01:15:14 0
K15/pGL3
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_44264 K15 promoter (-4.8) Mus musculus Ampicillin PMID:14708593 Alternate plasmid name: K15(-4.8)-pGL3 The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were CTGAGCTACCAGCGAGACTCC (K15F1) and TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1), respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGL3-Basic (Promega). The entire K15 promoter-luciferase transgene can be released by digestion with XhoI/SalI. Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Mouse Targeting, Luciferase; Bacterial Resistance:Ampicillin Contains the murine K15 promoter (-4.8) fragment 2026-08-15 01:15:13 1
K15-TK/pGL3
 
Resource Report
Resource Website
RRID:Addgene_44267 K15 promoter (-4.8) Mus musculus Ampicillin PMID:16288281 Alternate plasmid name: K15-HSV-TK-pGL3 The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were CTGAGCTACCAGCGAGACTCC (K15F1) and TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1), respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGL3-Basic (Promega) to create plasmid K15(-4.8)-pGL3 (Addgene plasmid #44264). The HSV-1 TK reporter gene cDNA was then excised from a TK/PBSIIKS plasmid, using NotI and SalI, and cloned downstream of the K15 promoter, replacing luciferase. The entire K15 promoter-HSV-TK transgene can be released by digestion with XhoI/SalI. Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Mouse Targeting, Thymidine kinase; Bacterial Resistance:Ampicillin Contains the murine K15 promoter (-4.8) fragment 2026-08-15 01:15:14 0
K15-EGFP
 
Resource Report
Resource Website
RRID:Addgene_44266 K15 promoter (-4.8) Mus musculus Kanamycin PMID:15024388 Alternate plasmid name: pEGFP-N2 K15 The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were CTGAGCTACCAGCGAGACTCC (K15F1) and TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1), respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGEGFP-N2 The entire K15 promoter-EGFP transgene can be released by digestion with XhoI/AflII. Backbone Marker:Clontech; Backbone Size:4737; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression, Mouse Targeting, Fluorescence microscopy; Bacterial Resistance:Kanamycin Contains the murine K15 promoter (-4.8) fragment 2026-08-15 01:15:14 0
pMH4-Syn1-Ratio1XsypHy
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_44268 SypHy1x-tdimer2(12) Ampicillin PMID:23522046 Vector Backbone:pMH4; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:15:14 1
pwtCas9-bacteria
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_44250 wild-type Cas9 S .pyogenes Ampicillin PMID:23452860 Vector Backbone:pUC19; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:13 17
pgRNA-bacteria
 
Resource Report
Resource Website
50+ mentions
RRID:Addgene_44251 guide RNA (bacteria) Ampicillin PMID:23452860 Vector Backbone:pUC19; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:13 73
pET-28a-hPKM2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_44242 Pyruvate Kinase M2 Homo sapiens Kanamycin PMID:18337815 Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:13 5
pdCas9-bacteria
 
Resource Report
Resource Website
50+ mentions
RRID:Addgene_44249 dCas9 (bacteria) S. pyogenes Chloramphenicol PMID:23452860 Vector Backbone:p15A vector; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol D10A H840A (catalytically inactive) 2026-08-15 01:15:14 82
pgRNA-humanized
 
Resource Report
Resource Website
50+ mentions
RRID:Addgene_44248 guide RNA Homo sapiens Ampicillin PMID:23452860 Vector Backbone:pU6; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:13 58
pET-28a-hPKM1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_44241 Pyruvate Kinase M1 Homo sapiens Kanamycin PMID:18337815 Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:14 7
pLHCX-FLAG-mPKM1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_44240 Pyruvate Kinase M1 Mus musculus Ampicillin PMID:18337823 Backbone Marker:Clontech; Backbone Size:6800; Vector Backbone:pLHCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:13 2
pLHCX-FLAG-mPKM2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_44239 Pyruvate Kinase M2 Mus musculus Ampicillin PMID:18337823 Backbone Marker:Clontech; Backbone Size:6800; Vector Backbone:pLHCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:13 5
BC-GPRC
 
Resource Report
Resource Website
RRID:Addgene_44199 human GPR56 C-terminal fragment Homo sapiens Ampicillin Backbone Marker:unknown; Backbone Size:7500; Vector Backbone:Barcode; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin C-terminal fragment of GPR56 starting at amino acid 383, right after the cleavage site in the GPS motif 2026-08-15 01:15:13 0
pFIN-EF1a-CHER-WPRE
 
Resource Report
Resource Website
RRID:Addgene_44353 EF1a-CHER Homo sapiens Ampicillin PMID:20517486 Backbone Marker:LJ Chang; Backbone Size:8760; Vector Backbone:pTY; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:14 0
BC-deltaSTP-GPR56
 
Resource Report
Resource Website
RRID:Addgene_44198 human deltaSTP-GPR56 Homo sapiens Ampicillin Backbone Marker:unknown; Backbone Size:7500; Vector Backbone:Barcode; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin deletion of amino acids 108 - 177 2026-08-15 01:15:14 0
pFIN-EF1a-GFP-WPRE
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_44352 EF1a-GFP Homo sapiens Ampicillin PMID:20517486 Backbone Marker:LJ Chang; Backbone Size:8738; Vector Backbone:pTY; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:15 1
pRCIscript-crhr1_TAL1A
 
Resource Report
Resource Website
RRID:Addgene_44234 crhr1 pTAL scaffold 1A Danio rerio Ampicillin PMID:23000899 Please note that some of the NN RVDs of this TALEN plasmid, which recognize G nucleotides were actually made with NK RVDs (which also recognize G nucleotides). This alters a single amino acid within the RVD Backbone Marker:Addgene plasmid 38142; Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:mRNA transcription vector; Bacterial Resistance:Ampicillin 2026-08-15 01:15:13 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.