Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: URA3
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21768125
Comments: The amplified region is functional, but does not overlap with the URA3 deletion region in BY4741 and derivatives, so will not recombine at the endogenous locus in this background.
Proper citation: RRID:Addgene_61924 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Telomerase RNA hairpin
Vector Backbone Description: Backbone Size:2686; Vector Backbone:Puc19; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23610127
Comments: FokI site follows RNA construct to linearize plasmid prior to in vitro transcription.
Proper citation: RRID:Addgene_61890 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Ty1H3 retrotransposon
Vector Backbone Description: Backbone Size:5500; Vector Backbone:unknown, pCGS42; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1846969
Proper citation: RRID:Addgene_62228 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Cre recombinase, I-SceI nuclease
Vector Backbone Description: Backbone Marker:Marois lab; Backbone Size:4407; Vector Backbone:pDSAR; Vector Types:Insect Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25869647
Proper citation: RRID:Addgene_62302 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: OSM1-EGFP fusion
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25378625
Proper citation: RRID:Addgene_62385 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: BirA-heh2-Ssh1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25378630
Proper citation: RRID:Addgene_62363 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: BirA-mVenus-Ubc6 tail anchor
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25378630
Proper citation: RRID:Addgene_62364 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: BirA-mVenus-Ssh1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25378630
Proper citation: RRID:Addgene_62362 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: FLP recombinase
Vector Backbone Description: Backbone Size:10090; Vector Backbone:pCASPER; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27172193
Comments: this vector is very similar to pMH5 (addgene 52531) but contains an activating point mutation (P2->S) and an additional N-terminal NLS
Proper citation: RRID:Addgene_72871 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: NDI1
Vector Backbone Description: Backbone Size:5639; Vector Backbone:pMXs-IRES-blasticidin; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24670634
Comments: The retroviral NDI1 vector was generated by cloning into the EcoRI and XhoI sites of the pMXS-ires-blast vector a cDNA insert generated by PCR using the primers below, followed by standard cloning techniques.
Ndi1 EcoRI F: ATGAATTCCATCACATCATCGAATTAC
Ndi1 XhoI R: ATCTCGAGAAAAGGGCATGTTAATTTCATCTATAAT
It is a retroviral plasmid so it may be recommended to be propagated at 30oc but author typically grows it at 37oC.
Proper citation: RRID:Addgene_72876 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: CUS2p
Vector Backbone Description: Backbone Marker:Midwest Center for Structural Genomics; Backbone Size:5704; Vector Backbone:p11; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26631165
Proper citation: RRID:Addgene_73046 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: CUS2p
Vector Backbone Description: Backbone Marker:Midwest Center for Structural Genomics; Backbone Size:5704; Vector Backbone:p11; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26631165
Proper citation: RRID:Addgene_73059 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Aga2P-HRP
Vector Backbone Description: Backbone Size:55791; Vector Backbone:pCTCON2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27240195
Comments: HRP = full-length horseradish peroxidase.
This vector contains the following features:
EcoRI-Aga2P-HA-TEVs-15 aa linker-NheI-HRP-3 aa linker-BamHI-myc-stop-XhoI
GAL1 promoter (galactose inducible)
15 aa linker: GGGGSGGGGSGGGGS
3 aa linker: GSG
HA: YPYDVPDYA
myc: EQKLISEEDL
TEVs: ENLYFQG, cleavage recognition site for TEV protease
This construct is derived from the previously reported Aga2P-HRP construct (Lam et. al. Nature Methods, 12, 51-54, 2015), except the codon optimization of the synthetic HRP gene is different in this construct.
Proper citation: RRID:Addgene_73152 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: sHRPa-Aga1P
Vector Backbone Description: Backbone Size:4781; Vector Backbone:YIP; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27240195
Comments: sHRPa is the large split HRP fragment. It consists of amino acids 1-213 of horseradish peroxidase (HRP) with the following 4 mutations: T21I, P78S, R93G, N175S.
The insert contains the following features:
BamHI-Aga1P ss-AflII-sHRPa-3 aa linker-V5 epitope tag-9 aa linker-NheI-Aga1P mature-stop-XhoI
glyceraldehyde-3-phosphate dehydrogenase
GPD promoter (constitutive)
3 aa linker: GSG
9 aa linker: GSGGGGSSG
V5 epitope tag: GKPIPNPLLGLDST
This plasmid was derived from the previously published “LAP-Aga1P” plasmid (White and Zegelbone, Biochemistry, 52, 3728-3739, 2013). When this vector is linearized by restriction digest, it incorporates into the yeast genome.
Proper citation: RRID:Addgene_73151 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: guiding RNA
Vector Backbone Description: Backbone Marker:Agilent; Backbone Size:7758; Vector Backbone:pESC-Leu; Vector Types:Yeast Expression, CRISPR, gRNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27166612
Proper citation: RRID:Addgene_73284 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: guiding RNA
Vector Backbone Description: Backbone Marker:Agilent; Backbone Size:7758; Vector Backbone:pESC-Leu; Vector Types:Yeast Expression, CRISPR, gRNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27166612
Comments: Please note that mutation A40T in nourseothricin was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.
Proper citation: RRID:Addgene_73282 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: guiding RNA
Vector Backbone Description: Backbone Marker:Agilent; Backbone Size:7758; Vector Backbone:pESC-Leu; Vector Types:Yeast Expression, CRISPR, gRNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27166612
Proper citation: RRID:Addgene_73283 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: guiding RNA
Vector Backbone Description: Backbone Marker:Agilent; Backbone Size:7758; Vector Backbone:pESC-Leu; Vector Types:Yeast Expression, CRISPR, gRNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27166612
Proper citation: RRID:Addgene_73288 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: guiding RNA
Vector Backbone Description: Backbone Marker:Agilent; Backbone Size:7758; Vector Backbone:pESC-Leu; Vector Types:Yeast Expression, CRISPR, gRNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27166612
Proper citation: RRID:Addgene_73287 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: guiding RNA
Vector Backbone Description: Backbone Marker:Agilent; Backbone Size:7758; Vector Backbone:pESC-Leu; Vector Types:Yeast Expression, CRISPR, gRNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27166612
Comments: Please note that mutation A40T in nourseothricin was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.
Proper citation: RRID:Addgene_73292 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
