Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:saccharomyces cerevisiae (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

4,486 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pFA6a URA3
 
Resource Report
Resource Website 		RRID:Addgene_61924 URA3 Saccharomyces cerevisiae Ampicillin PMID:21768125 The amplified region is functional, but does not overlap with the URA3 deletion region in BY4741 and derivatives, so will not recombine at the endogenous locus in this background. Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin 2026-08-15 01:17:47 0
pAD01 S. cerevisiae telomerase RNA KBS
 
Resource Report
Resource Website 		RRID:Addgene_61890 Telomerase RNA hairpin Saccharomyces cerevisiae Ampicillin PMID:23610127 FokI site follows RNA construct to linearize plasmid prior to in vitro transcription. Backbone Size:2686; Vector Backbone:Puc19; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:17:47 0
pGTy1mhis3-AI or pGTy1his3-AI
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_62228 Ty1H3 retrotransposon Saccharomyces cerevisiae Ampicillin PMID:1846969 Backbone Size:5500; Vector Backbone:unknown, pCGS42; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:51 2
pDSAR-Cre-F2A-I-SceI
 
Resource Report
Resource Website 		RRID:Addgene_62302 Cre recombinase, I-SceI nuclease Saccharomyces cerevisiae Kanamycin PMID:25869647 Backbone Marker:Marois lab; Backbone Size:4407; Vector Backbone:pDSAR; Vector Types:Insect Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:51 0
pJW1515
 
Resource Report
Resource Website 		RRID:Addgene_62385 OSM1-EGFP fusion Saccharomyces cerevisiae Ampicillin PMID:25378625 Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:52 0
pJW1509
 
Resource Report
Resource Website 		RRID:Addgene_62363 BirA-heh2-Ssh1 Saccharomyces cerevisiae Ampicillin PMID:25378630 Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:52 0
pJW1510
 
Resource Report
Resource Website 		RRID:Addgene_62364 BirA-mVenus-Ubc6 tail anchor Saccharomyces cerevisiae Ampicillin PMID:25378630 Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin L232H mutation compared to standard mVenus 2026-08-15 01:17:52 0
pJW1508
 
Resource Report
Resource Website 		RRID:Addgene_62362 BirA-mVenus-Ssh1 Saccharomyces cerevisiae Ampicillin PMID:25378630 Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:52 0
pKF295
 
Resource Report
Resource Website 		RRID:Addgene_72871 FLP recombinase Saccharomyces cerevisiae Ampicillin PMID:27172193 this vector is very similar to pMH5 (addgene 52531) but contains an activating point mutation (P2->S) and an additional N-terminal NLS Backbone Size:10090; Vector Backbone:pCASPER; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin P2->S, added NLS 2026-08-15 01:19:23 0
PMXS-NDI1
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_72876 NDI1 Saccharomyces cerevisiae Ampicillin PMID:24670634 The retroviral NDI1 vector was generated by cloning into the EcoRI and XhoI sites of the pMXS-ires-blast vector a cDNA insert generated by PCR using the primers below, followed by standard cloning techniques. Ndi1 EcoRI F: ATGAATTCCATCACATCATCGAATTAC Ndi1 XhoI R: ATCTCGAGAAAAGGGCATGTTAATTTCATCTATAAT It is a retroviral plasmid so it may be recommended to be propagated at 30oc but author typically grows it at 37oC. Backbone Size:5639; Vector Backbone:pMXs-IRES-blasticidin; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:19:23 27
wt Cus2p
 
Resource Report
Resource Website 		RRID:Addgene_73046 CUS2p Saccharomyces cerevisiae Ampicillin PMID:26631165 Backbone Marker:Midwest Center for Structural Genomics; Backbone Size:5704; Vector Backbone:p11; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:19:25 0
L284F Cus2p
 
Resource Report
Resource Website 		RRID:Addgene_73059 CUS2p Saccharomyces cerevisiae Ampicillin PMID:26631165 Backbone Marker:Midwest Center for Structural Genomics; Backbone Size:5704; Vector Backbone:p11; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin Leucine 284 to Phenylalanine 2026-08-15 01:19:25 0
pCTCON2 Aga2P-HRP
 
Resource Report
Resource Website 		RRID:Addgene_73152 Aga2P-HRP Saccharomyces cerevisiae Ampicillin PMID:27240195 HRP = full-length horseradish peroxidase. This vector contains the following features: EcoRI-Aga2P-HA-TEVs-15 aa linker-NheI-HRP-3 aa linker-BamHI-myc-stop-XhoI GAL1 promoter (galactose inducible) 15 aa linker: GGGGSGGGGSGGGGS 3 aa linker: GSG HA: YPYDVPDYA myc: EQKLISEEDL TEVs: ENLYFQG, cleavage recognition site for TEV protease This construct is derived from the previously reported Aga2P-HRP construct (Lam et. al. Nature Methods, 12, 51-54, 2015), except the codon optimization of the synthetic HRP gene is different in this construct. Backbone Size:55791; Vector Backbone:pCTCON2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:19:26 0
YIP sHRPa-Aga1P
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_73151 sHRPa-Aga1P Saccharomyces cerevisiae Ampicillin PMID:27240195 sHRPa is the large split HRP fragment. It consists of amino acids 1-213 of horseradish peroxidase (HRP) with the following 4 mutations: T21I, P78S, R93G, N175S. The insert contains the following features: BamHI-Aga1P ss-AflII-sHRPa-3 aa linker-V5 epitope tag-9 aa linker-NheI-Aga1P mature-stop-XhoI glyceraldehyde-3-phosphate dehydrogenase GPD promoter (constitutive) 3 aa linker: GSG 9 aa linker: GSGGGGSSG V5 epitope tag: GKPIPNPLLGLDST This plasmid was derived from the previously published “LAP-Aga1P” plasmid (White and Zegelbone, Biochemistry, 52, 3728-3739, 2013). When this vector is linearized by restriction digest, it incorporates into the yeast genome. Backbone Size:4781; Vector Backbone:YIP; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:19:26 2
pCfB3042(gRNA X-4)
 
Resource Report
Resource Website 		RRID:Addgene_73284 guiding RNA Saccharomyces cerevisiae Ampicillin PMID:27166612 Backbone Marker:Agilent; Backbone Size:7758; Vector Backbone:pESC-Leu; Vector Types:Yeast Expression, CRISPR, gRNA; Bacterial Resistance:Ampicillin 2026-08-15 01:19:27 0
pCfB3020(gRNA X-2)
 
Resource Report
Resource Website 		RRID:Addgene_73282 guiding RNA Saccharomyces cerevisiae Ampicillin PMID:27166612 Please note that mutation A40T in nourseothricin was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function. Backbone Marker:Agilent; Backbone Size:7758; Vector Backbone:pESC-Leu; Vector Types:Yeast Expression, CRISPR, gRNA; Bacterial Resistance:Ampicillin 2026-08-15 01:19:27 0
pCfB3041(gRNA X-3)
 
Resource Report
Resource Website 		RRID:Addgene_73283 guiding RNA Saccharomyces cerevisiae Ampicillin PMID:27166612 Backbone Marker:Agilent; Backbone Size:7758; Vector Backbone:pESC-Leu; Vector Types:Yeast Expression, CRISPR, gRNA; Bacterial Resistance:Ampicillin 2026-08-15 01:19:27 0
pCfB3046(gRNA XI-5)
 
Resource Report
Resource Website 		RRID:Addgene_73288 guiding RNA Saccharomyces cerevisiae Ampicillin PMID:27166612 Backbone Marker:Agilent; Backbone Size:7758; Vector Backbone:pESC-Leu; Vector Types:Yeast Expression, CRISPR, gRNA; Bacterial Resistance:Ampicillin 2026-08-15 01:19:27 0
pCfB3045(gRNA XI-3)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_73287 guiding RNA Saccharomyces cerevisiae Ampicillin PMID:27166612 Backbone Marker:Agilent; Backbone Size:7758; Vector Backbone:pESC-Leu; Vector Types:Yeast Expression, CRISPR, gRNA; Bacterial Resistance:Ampicillin 2026-08-15 01:19:27 1
pCfB3050(gRNA XII-5)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_73292 guiding RNA Saccharomyces cerevisiae Ampicillin PMID:27166612 Please note that mutation A40T in nourseothricin was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function. Backbone Marker:Agilent; Backbone Size:7758; Vector Backbone:pESC-Leu; Vector Types:Yeast Expression, CRISPR, gRNA; Bacterial Resistance:Ampicillin 2026-08-15 01:19:27 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch