Plasmids   Select Another Resource Report Type

http://www.addgene.org/92108

Species: Mus musculus
Genetic Insert: Mefv isoform1
Vector Backbone Description: Vector Backbone:pLenti-NIrD; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27482109

Proper citation: RRID:Addgene_92108 Copy   

•   Source: Addgene

http://www.addgene.org/92107

Species: Mus musculus
Genetic Insert: Mefv isoform1
Vector Backbone Description: Vector Backbone:pGAD-GH; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27482109

Proper citation: RRID:Addgene_92107 Copy   

•   Source: Addgene

http://www.addgene.org/92105

Species: Mus musculus
Genetic Insert: Mefv isoform1
Vector Backbone Description: Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27482109

Proper citation: RRID:Addgene_92105 Copy   

•   Source: Addgene

http://www.addgene.org/92140

Species: Mus musculus
Genetic Insert: AID[71-114]-eGFP
Vector Backbone Description: Vector Backbone:pEN84 (Addgene #86230); Vector Types:Mammalian Expression, Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28525758
Comments: use with pX335-EN475 and pX335-EN477 (Cas9nickase + paired sgRNA against mouse CTCF stop codon)

Proper citation: RRID:Addgene_92140 Copy   

•   Source: Addgene

http://www.addgene.org/92164

Species: Mus musculus
Genetic Insert: Haunt P-Inr2-cDNA KI homology arms
Vector Backbone Description: Vector Backbone:PiggyBac; Vector Types:Other; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25891907
Comments: HA inserts are 472 and 572. Please note that there are some discrepancies between Addgene's quality control sequence and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.

Proper citation: RRID:Addgene_92164 Copy   

•   Source: Addgene

http://www.addgene.org/92165

Species: Mus musculus
Genetic Insert: Evx1as short isoform
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26996597
Comments: Please note that there are some discrepancies between Addgene's quality control sequence and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.

Proper citation: RRID:Addgene_92165 Copy   

•   Source: Addgene

http://www.addgene.org/92163

Species: Mus musculus
Genetic Insert: Haunt CAG KI homology arms
Vector Backbone Description: Vector Backbone:PiggyBac; Vector Types:Other; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25891907
Comments: HA inserts are 497 and 552bp. Please note that there are some discrepancies between Addgene's quality control sequence and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.

Proper citation: RRID:Addgene_92163 Copy   

•   Source: Addgene

http://www.addgene.org/90249

Species: Mus musculus
Genetic Insert: psd95-exon18
Vector Backbone Description: Vector Backbone:pflareA; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23636947

Proper citation: RRID:Addgene_90249 Copy   

•   Source: Addgene

http://www.addgene.org/90426

Species: Mus musculus
Genetic Insert: Sf3b1 - left and right homology arms
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pL452; Vector Types:homology-directed repair vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30462273

Proper citation: RRID:Addgene_90426 Copy   

•   Source: Addgene

http://www.addgene.org/90425

Species: Mus musculus
Genetic Insert: Sf3b1 - left and right homology arms
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pL452; Vector Types:homology-directed repair vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30462273

Proper citation: RRID:Addgene_90425 Copy   

•   Source: Addgene

http://www.addgene.org/90424

Species: Mus musculus
Genetic Insert: mus Sf3b1 gRNA
Vector Backbone Description: Backbone Marker:Feng Zhang; Vector Backbone:pSpCas9(BB)-2A-Puro (PX459) V2.0; Vector Types:Mammalian Expression, CRISPR, guideRNA encoding for gene editing; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30462273

Proper citation: RRID:Addgene_90424 Copy   

•   Source: Addgene

http://www.addgene.org/9058

Species: Mus musculus
Genetic Insert: p53 DD
Vector Backbone Description: Backbone Size:5558; Vector Backbone:pBABE hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11884599

Proper citation: RRID:Addgene_9058 Copy   

•   Source: Addgene

http://www.addgene.org/44027

Species: Mus musculus
Genetic Insert: mHIF-2α (P405A/P530V/N851A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17804822
Comments: This plasmid encodes an oxygen-regulation insensitive (normoxia-stable and active) full-length murine HIF-2α. Full-length murine HIF-2α cDNA was generated by reverse transcription-PCR and inserted into a pcDNA3 expression vector by using primers incorporated with restriction sites. A 10-amino-acid c-myc tag was further inserted at the C terminus of the HIF-2α cDNAs by using a Pfu-PCR-based protocol. The same Pfu-PCR protocol was then used to change residues Proline 405, Proline 530 and Asparagine 851. The newly constructed plasmid was sequenced to confirm encoding of the correct protein. This plasmid has an A94V polymorphism that does not affect protein function. Alternate plasmid names: HIF-2α triple mutant (TM); pcDNA3 HIF-2α TM

Proper citation: RRID:Addgene_44027 Copy   

•   Source: Addgene

http://www.addgene.org/44028

Species: Mus musculus
Genetic Insert: mHIF-1α (P402A/P577A/N813A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17804822
Comments: This plasmid encodes an oxygen-regulation insensitive (normoxia-stable and active) full-length murine HIF-1α. Full-length murine HIF-1α cDNA was generated by reverse transcription-PCR and inserted into a pcDNA3 expression vector by using primers incorporated with restriction sites. A 10-amino-acid c-myc tag was further inserted at the C terminus of the HIF-1α cDNAs by using a Pfu-PCR-based protocol. The same Pfu-PCR protocol was then used to change residues Proline 402, Proline 577 and Asparagine 813 to alanines. The newly constructed plasmid was sequenced to confirm encoding of the correct protein. Alternate plasmid names: HIF-1α triple mutant (TM); pcDNA3 HIF-1α TM

Proper citation: RRID:Addgene_44028 Copy   

•   Source: Addgene

http://www.addgene.org/43969

Species: Mus musculus
Genetic Insert: Cbx5
Vector Backbone Description: Backbone Size:8600; Vector Backbone:N103; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22704655

Proper citation: RRID:Addgene_43969 Copy   

•   Source: Addgene

http://www.addgene.org/43926

Species: Mus musculus
Genetic Insert: TNF Receptor-Associated Factor 6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pCR3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17135271

Proper citation: RRID:Addgene_43926 Copy   

•   Source: Addgene

http://www.addgene.org/44160

Species: Mus musculus
Genetic Insert: Tak1
Vector Backbone Description: Vector Backbone:pRK6-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16260783

Proper citation: RRID:Addgene_44160 Copy   

•   Source: Addgene

http://www.addgene.org/44264

Species: Mus musculus
Genetic Insert: K15 promoter (-4.8)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Mouse Targeting, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14708593
Comments: Alternate plasmid name: K15(-4.8)-pGL3 The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were CTGAGCTACCAGCGAGACTCC (K15F1) and TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1), respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGL3-Basic (Promega). The entire K15 promoter-luciferase transgene can be released by digestion with XhoI/SalI.

Proper citation: RRID:Addgene_44264 Copy   

•   Source: Addgene

http://www.addgene.org/44267

Species: Mus musculus
Genetic Insert: K15 promoter (-4.8)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Mouse Targeting, Thymidine kinase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16288281
Comments: Alternate plasmid name: K15-HSV-TK-pGL3 The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were CTGAGCTACCAGCGAGACTCC (K15F1) and TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1), respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGL3-Basic (Promega) to create plasmid K15(-4.8)-pGL3 (Addgene plasmid #44264). The HSV-1 TK reporter gene cDNA was then excised from a TK/PBSIIKS plasmid, using NotI and SalI, and cloned downstream of the K15 promoter, replacing luciferase. The entire K15 promoter-HSV-TK transgene can be released by digestion with XhoI/SalI.

Proper citation: RRID:Addgene_44267 Copy   

•   Source: Addgene

http://www.addgene.org/44266

Species: Mus musculus
Genetic Insert: K15 promoter (-4.8)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4737; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression, Mouse Targeting, Fluorescence microscopy; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15024388
Comments: Alternate plasmid name: pEGFP-N2 K15 The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were CTGAGCTACCAGCGAGACTCC (K15F1) and TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1), respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGEGFP-N2 The entire K15 promoter-EGFP transgene can be released by digestion with XhoI/AflII.

Proper citation: RRID:Addgene_44266 Copy   

•   Source: Addgene