Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pRAJ22
 
Resource Report
Resource Website
RRID:Addgene_39251 RAJ22 system Ampicillin and Kanamycin PMID:22949707 Backbone Marker:Jaramillo Lab; Backbone Size:4042; Vector Backbone:pSTC0; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:14:26 0
pRAJ23
 
Resource Report
Resource Website
RRID:Addgene_39253 RAJ23 system Ampicillin and Kanamycin PMID:22949707 Backbone Marker:Jaramillo Lab; Backbone Size:4042; Vector Backbone:pSTC0; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:14:26 0
pCAG:Kaede
 
Resource Report
Resource Website
RRID:Addgene_39261 Kaede Mus musculus Ampicillin PMID:19740427 Vector Backbone:pCS2-Kaede; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:26 0
TAL2049
 
Resource Report
Resource Website
RRID:Addgene_39407 eGFP-TALEN-25-Right Homo sapiens Ampicillin PMID:22484455 Target binding site: TCGGCGAGCTGCACG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2048
 
Resource Report
Resource Website
RRID:Addgene_39406 eGFP-TALEN-25-Left Homo sapiens Ampicillin PMID:22484455 Target binding site: TCAAGATCCGCCACA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2045
 
Resource Report
Resource Website
RRID:Addgene_39403 eGFP-TALEN-23-Right Homo sapiens Ampicillin PMID:22484455 Target binding site: TCGTCCTTGAAGAAG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2047
 
Resource Report
Resource Website
RRID:Addgene_39405 eGFP-TALEN-24-Right Homo sapiens Ampicillin PMID:22484455 Target binding site: TTGCCGTCCTCCTTG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2010
 
Resource Report
Resource Website
RRID:Addgene_39368 eGFP-TALEN-06-Left Homo sapiens Ampicillin PMID:22484455 Target binding site: TGCCACCTACG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.6kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:27 0
TAL2009
 
Resource Report
Resource Website
RRID:Addgene_39367 eGFP-TALEN-05-Right Homo sapiens Ampicillin PMID:22484455 Target binding site: TAGGTGGCATC To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.6kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32287); Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:27 0
TAL2042
 
Resource Report
Resource Website
RRID:Addgene_39400 eGFP-TALEN-22-Left Homo sapiens Ampicillin PMID:22484455 Target binding site: TGGTGCCCATCCTGG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2013
 
Resource Report
Resource Website
RRID:Addgene_39371 eGFP-TALEN-07-Right Homo sapiens Ampicillin PMID:22484455 Target binding site: TGCACGCCGTA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.6kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:27 0
pC-attB-burs-mCD8-EGFP-T2A-Gal4
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_39463 burs-mCD8-EGFP-T2A-Gal4 Ampicillin PMID:22209908 Backbone Size:8491; Vector Backbone:pC-attB; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 2
pPac-PL-mCD8-D2A-Gal4
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_39457 mCD8-D2A-Gal4 Ampicillin PMID:22209908 Backbone Size:6392; Vector Backbone:pPac-PL; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 1
pPac-PL-mCD8-F2A-Gal4
 
Resource Report
Resource Website
RRID:Addgene_39459 mCD8-F2A-Gal4 Ampicillin PMID:22209908 Backbone Size:6392; Vector Backbone:pPac-PL; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2085
 
Resource Report
Resource Website
RRID:Addgene_39453 eGFP-TALEN-48-Right Homo sapiens Ampicillin PMID:22484455 Target binding site: TTGAAGTCGATGCCCTTCAGC To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.6kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32287); Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
pPac-PL-mCD8-Gal4
 
Resource Report
Resource Website
RRID:Addgene_39456 mCD8-Gal4 Ampicillin PMID:22209908 Backbone Size:6392; Vector Backbone:pPac-PL; Vector Types:S2; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
pAAV-EF1a-HA-hTet1CDmu-WPRE-PolyA
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_39455 HA-hTet1CDmu Homo sapiens Ampicillin PMID:21496894 Backbone Size:5321; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin aa1418–2136 with mutations H1672 to Y, 1674D to A 2026-08-15 01:14:28 4
TAL2080
 
Resource Report
Resource Website
RRID:Addgene_39450 eGFP-TALEN-47-Left Homo sapiens Ampicillin PMID:22484455 Target binding site: TTCATCTGCACCACCGGCAAG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.6kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2076
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_39446 eGFP-TALEN-45-Left Homo sapiens Ampicillin PMID:22484455 Target binding site: TTCAAGTCCGCCATGCCCGA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.5kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 1
TAL2075
 
Resource Report
Resource Website
RRID:Addgene_39445 eGFP-TALEN-44-Right Homo sapiens Ampicillin PMID:22484455 Target binding site: TAGGTCAGGGTGGTCACGAG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.5kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.