Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Size:15615; Vector Backbone:pTC223; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin
Comments: Addgene NGS results identified an IS5 element immediately upstream of KanR, which should not affect plasmid function.
Proper citation: RRID:Addgene_112797 Copy
Species: Aequorea victoria
Genetic Insert: EGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5078; Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30166341
Comments: The N-terminal tag sequence of this insert is exactly the same as in pcDNA4/TO-bio-myc-cCE, thus providing a specificity control for pulldown assays.
Proper citation: RRID:Addgene_112712 Copy
Species: Mus musculus
Genetic Insert: Rngtt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5078; Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30166341
Comments: For more information about this plasmid, see Mukherjee et al. 2014 PLoS Biol (10.1371/journal.pbio.1001933). The insert sequence of this plasmid was subcloned from pcDNA3-bio-myc-NES-mCEΔNLS described in this publication.
Additional internal sequencing primers:
IntCE1-F: GAATGCCCCACCACTGAGAATACTG
IntCE2-F: GTTAGGAGAGGTGCAGCAGAAATGTC
IntCE3-F: CAAAGAAGTCAGCCATGAAATGGATGGAC
Proper citation: RRID:Addgene_112711 Copy
Species: Homo sapiens
Genetic Insert: CFP-KRAS4B
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:5446; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29336889
Proper citation: RRID:Addgene_112717 Copy
Species: Mus musculus
Genetic Insert: Rngtt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30166341
Comments: This plasmid encodes the guanylyltransferase domain of RNGTT.
Proper citation: RRID:Addgene_112716 Copy
Species: Mus musculus
Genetic Insert: Rngtt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30166341
Comments: This plasmid encodes the triphosphatase domain of RNGTT.
Proper citation: RRID:Addgene_112715 Copy
Species: Homo sapiens
Genetic Insert: YFP-KRAS4B
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29336889
Proper citation: RRID:Addgene_112718 Copy
Species: Homo sapiens
Genetic Insert: RNMT
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28981715
Proper citation: RRID:Addgene_112708 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: PPX1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5708; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24560923
Comments: This plasmid was originally constructed by Dr. Michael Gray in the lab of Dr. Ursula Jakob (University of Michigan).
Proper citation: RRID:Addgene_112877 Copy
Species: Synthetic
Genetic Insert: dCas9VP64-T2A-Blast
Vector Backbone Description: Backbone Size:8000; Vector Backbone:pKLV2-EF1a-W; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30477585
Proper citation: RRID:Addgene_112919 Copy
Genetic Insert: eGFP
Vector Backbone Description: Backbone Size:6124; Vector Backbone:pMLS7; Vector Types:Bacterial Expression; Bacterial Resistance:Trimethoprim
Defining Citation: PMID:12450816
Proper citation: RRID:Addgene_112917 Copy
Species: AAV
Genetic Insert: Rep2/Cap7
Vector Backbone Description: Vector Backbone:unknown; Vector Types:AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_112863 Copy
Species: Rattus norvegicus
Genetic Insert: APOBEC1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4727; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_112861 Copy
Species: adenovirus
Genetic Insert: E4, E2a and VA
Vector Backbone Description: Vector Backbone:unknown; Vector Types:AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_112867 Copy
Species: AAV
Genetic Insert: Rep2/Cap-rh10
Vector Backbone Description: Vector Backbone:unknown; Vector Types:AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_112866 Copy
Species: Synthetic
Genetic Insert: T2A-H2B-GFP
Vector Backbone Description: Vector Backbone:pBluescript SK (-); Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29889212
Proper citation: RRID:Addgene_112851 Copy
Species: Synthetic
Genetic Insert: mCherry-apoB-EGFP
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25806564
Proper citation: RRID:Addgene_112859 Copy
Genetic Insert: EGFP
Vector Backbone Description: Vector Backbone:pBluescript SK (-); Vector Types:Unspecified, general donor; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29889212
Proper citation: RRID:Addgene_112848 Copy
Species: Mus musculus
Genetic Insert: LL5BIP
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1(+)/Puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: https://sciencematters.io/articles/201610000003
Proper citation: RRID:Addgene_112829 Copy
Species: Mus musculus
Genetic Insert: LL5b
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1(+)/Puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23525008
Comments: LL5b contains a P815S difference compared to NM_153412.4 that does not impact function.
Proper citation: RRID:Addgene_112828 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
