Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
TAL2074 Resource Report Resource Website |
RRID:Addgene_39444 | eGFP-TALEN-44-Left | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TGCACCACCGGCAAGCTGCC To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.5kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32287); Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2071 Resource Report Resource Website |
RRID:Addgene_39441 | eGFP-TALEN-42-Right | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TGTGGCGGATCTTGAAGTT To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.4kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32290); Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2070 Resource Report Resource Website |
RRID:Addgene_39440 | eGFP-TALEN-42-Left | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TCATGGCCGACAAGCAGAA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.4kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2069 Resource Report Resource Website |
RRID:Addgene_39439 | eGFP-TALEN-41-Right | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TGTGGTCGGGGTAGCGGCT To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.4kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32290); Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2066 Resource Report Resource Website |
RRID:Addgene_39436 | eGFP-TALEN-40-Left | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TGAAGTTCATCTGCACCAC To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.4kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32287); Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2065 Resource Report Resource Website |
RRID:Addgene_39435 | eGFP-TALEN-39-Right | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TCAGGGTCAGCTTGCCGTA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.4kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2098 Resource Report Resource Website |
RRID:Addgene_39432 | eGFP-TALEN-38-Left | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: tgcagtgcttcagccgct To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32290); Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2040 Resource Report Resource Website |
RRID:Addgene_39398 | eGFP-TALEN-21-Left | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TACAACAGCCACAA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.9kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2064 Resource Report Resource Website |
RRID:Addgene_39434 | eGFP-TALEN-39-Left | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TCAGCGTGTCCGGCGAGGG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.4kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2099 Resource Report Resource Website |
RRID:Addgene_39433 | eGFP-TALEN-38-Right | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: tTGAAGAAGTCGTGCTGC To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32287); Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2036 Resource Report Resource Website |
RRID:Addgene_39394 | eGFP-TALEN-19-Left | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TTCAGCGTGTCCGG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.9kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2096 Resource Report Resource Website |
RRID:Addgene_39430 | eGFP-TALEN-37-Left | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TAAACGGCCACAAGTTCA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2094 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39428 | eGFP-TALEN-36-Left | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TCACCGGGGTGGTGCCCA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 1 | |
|
TAL2091 Resource Report Resource Website |
RRID:Addgene_39425 | eGFP-TALEN-34-Right | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TTGTAGTTGTACTCCAG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.2kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2090 Resource Report Resource Website |
RRID:Addgene_39424 | eGFP-TALEN-34-Left | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TTCAAGGAGGACGGCAA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.2kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2087 Resource Report Resource Website |
RRID:Addgene_39421 | eGFP-TALEN-32-Right | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TCGGGCATGGCGGACTT To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.2kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32290); Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2086 Resource Report Resource Website |
RRID:Addgene_39420 | eGFP-TALEN-32-Left | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TACCCCGACCACATGAA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.2kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2063 Resource Report Resource Website |
RRID:Addgene_39423 | eGFP-TALEN-33-Right | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TCCTTGAAGAAGATGGT To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.2kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32290); Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:28 | 0 | |
|
TAL2031 Resource Report Resource Website |
RRID:Addgene_39389 | eGFP-TALEN-16-Right | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TGTACTCCAGCTT To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.8kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32290); Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:27 | 0 | |
|
TAL2025 Resource Report Resource Website |
RRID:Addgene_39383 | eGFP-TALEN-13-Right | Homo sapiens | Ampicillin | PMID:22484455 | Target binding site: TGAACTTGTGGCC To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.8kb and 5.8kb | Backbone Marker:Joung lab (Addgene Plasmid # 32287); Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:27 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.