Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
TAL2074
 
Resource Report
Resource Website 		RRID:Addgene_39444 eGFP-TALEN-44-Left Homo sapiens Ampicillin PMID:22484455 Target binding site: TGCACCACCGGCAAGCTGCC To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.5kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32287); Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2071
 
Resource Report
Resource Website 		RRID:Addgene_39441 eGFP-TALEN-42-Right Homo sapiens Ampicillin PMID:22484455 Target binding site: TGTGGCGGATCTTGAAGTT To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.4kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32290); Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2070
 
Resource Report
Resource Website 		RRID:Addgene_39440 eGFP-TALEN-42-Left Homo sapiens Ampicillin PMID:22484455 Target binding site: TCATGGCCGACAAGCAGAA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.4kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2069
 
Resource Report
Resource Website 		RRID:Addgene_39439 eGFP-TALEN-41-Right Homo sapiens Ampicillin PMID:22484455 Target binding site: TGTGGTCGGGGTAGCGGCT To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.4kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32290); Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2066
 
Resource Report
Resource Website 		RRID:Addgene_39436 eGFP-TALEN-40-Left Homo sapiens Ampicillin PMID:22484455 Target binding site: TGAAGTTCATCTGCACCAC To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.4kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32287); Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2065
 
Resource Report
Resource Website 		RRID:Addgene_39435 eGFP-TALEN-39-Right Homo sapiens Ampicillin PMID:22484455 Target binding site: TCAGGGTCAGCTTGCCGTA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.4kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2098
 
Resource Report
Resource Website 		RRID:Addgene_39432 eGFP-TALEN-38-Left Homo sapiens Ampicillin PMID:22484455 Target binding site: tgcagtgcttcagccgct To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32290); Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2040
 
Resource Report
Resource Website 		RRID:Addgene_39398 eGFP-TALEN-21-Left Homo sapiens Ampicillin PMID:22484455 Target binding site: TACAACAGCCACAA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.9kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2064
 
Resource Report
Resource Website 		RRID:Addgene_39434 eGFP-TALEN-39-Left Homo sapiens Ampicillin PMID:22484455 Target binding site: TCAGCGTGTCCGGCGAGGG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.4kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2099
 
Resource Report
Resource Website 		RRID:Addgene_39433 eGFP-TALEN-38-Right Homo sapiens Ampicillin PMID:22484455 Target binding site: tTGAAGAAGTCGTGCTGC To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32287); Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2036
 
Resource Report
Resource Website 		RRID:Addgene_39394 eGFP-TALEN-19-Left Homo sapiens Ampicillin PMID:22484455 Target binding site: TTCAGCGTGTCCGG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.9kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2096
 
Resource Report
Resource Website 		RRID:Addgene_39430 eGFP-TALEN-37-Left Homo sapiens Ampicillin PMID:22484455 Target binding site: TAAACGGCCACAAGTTCA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2094
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_39428 eGFP-TALEN-36-Left Homo sapiens Ampicillin PMID:22484455 Target binding site: TCACCGGGGTGGTGCCCA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 1
TAL2091
 
Resource Report
Resource Website 		RRID:Addgene_39425 eGFP-TALEN-34-Right Homo sapiens Ampicillin PMID:22484455 Target binding site: TTGTAGTTGTACTCCAG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.2kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2090
 
Resource Report
Resource Website 		RRID:Addgene_39424 eGFP-TALEN-34-Left Homo sapiens Ampicillin PMID:22484455 Target binding site: TTCAAGGAGGACGGCAA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.2kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2087
 
Resource Report
Resource Website 		RRID:Addgene_39421 eGFP-TALEN-32-Right Homo sapiens Ampicillin PMID:22484455 Target binding site: TCGGGCATGGCGGACTT To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.2kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32290); Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2086
 
Resource Report
Resource Website 		RRID:Addgene_39420 eGFP-TALEN-32-Left Homo sapiens Ampicillin PMID:22484455 Target binding site: TACCCCGACCACATGAA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.2kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2063
 
Resource Report
Resource Website 		RRID:Addgene_39423 eGFP-TALEN-33-Right Homo sapiens Ampicillin PMID:22484455 Target binding site: TCCTTGAAGAAGATGGT To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.2kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32290); Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:28 0
TAL2031
 
Resource Report
Resource Website 		RRID:Addgene_39389 eGFP-TALEN-16-Right Homo sapiens Ampicillin PMID:22484455 Target binding site: TGTACTCCAGCTT To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.8kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32290); Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:27 0
TAL2025
 
Resource Report
Resource Website 		RRID:Addgene_39383 eGFP-TALEN-13-Right Homo sapiens Ampicillin PMID:22484455 Target binding site: TGAACTTGTGGCC To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.8kb and 5.8kb Backbone Marker:Joung lab (Addgene Plasmid # 32287); Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:27 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch