Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 168 showing 3341 ~ 3360 out of 12,959 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_45096

http://www.addgene.org/45096

Species: Mus musculus
Genetic Insert: nAChR beta2
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21187334
Comments: Pi ; Henry A. Lester β2 was cloned into pCI-neo at the restriction site EcoRI

Proper citation: RRID:Addgene_45096 Copy   


  • RRID:Addgene_45243

http://www.addgene.org/45243

Species: Mus musculus
Genetic Insert: Rec8
Vector Backbone Description: Backbone Marker:Millipore; Vector Backbone:pET45b+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20817534

Proper citation: RRID:Addgene_45243 Copy   


http://www.addgene.org/45382

Species: Mus musculus
Genetic Insert: Src-KD-UniRapR-mCerulean-myc
Vector Backbone Description: Vector Backbone:pUSE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23569285

Proper citation: RRID:Addgene_45382 Copy   


http://www.addgene.org/45526

Species: Mus musculus
Genetic Insert: PKA regulatory subunit RI beta tagged by mEGFP
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19447092

Proper citation: RRID:Addgene_45526 Copy   


  • RRID:Addgene_45482

    This resource has 1+ mentions.

http://www.addgene.org/45482

Species: Mus musculus
Genetic Insert: TRPM7
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4/TO (modified); Vector Types:Mammalian Expression, Tetracycline Inducible; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11385574
Comments: For the purpose of expressing LTRPC7 in eukaryotic cells, the depositing lab used PCR to produce an epitope tagged expression construct from two overlapping murine LTRPC7 clones. The LTRPC7 coding sequence was modified by removing the initiating methionine and replacing it with a sequence encoding a Kozak sequence, the FLAG tag and the additional sequence GCGGCCGCAT, and by placing a SpeI site just after the stop codon. These modifications result in an expressed protein which started with the following amino acid sequence: MGDYKDDDDKRPH followed by the murine LTRPC7 coding sequence starting at the second amino acid. This construct is expressed from the pcDNA4/TO vector which provides tetracycline-controlled expression from a CMV promotor.

Proper citation: RRID:Addgene_45482 Copy   


  • RRID:Addgene_45501

    This resource has 1+ mentions.

http://www.addgene.org/45501

Species: Mus musculus
Genetic Insert: PGC-1alpha Isoform1
Vector Backbone Description: Backbone Size:5424; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23217713
Comments: Note that Addgene NGS results identified a Q339K mutation relative to the canonical GenBank sequence. This mutation has not been reported to affect function.

Proper citation: RRID:Addgene_45501 Copy   


  • RRID:Addgene_45553

http://www.addgene.org/45553

Species: Mus musculus
Genetic Insert: Hoxc6
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pCAGGs; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23359544

Proper citation: RRID:Addgene_45553 Copy   


  • RRID:Addgene_45532

    This resource has 1+ mentions.

http://www.addgene.org/45532

Species: Mus musculus
Genetic Insert: alpha Klotho
Vector Backbone Description: Backbone Size:5710; Vector Backbone:pCR3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:26881702

Proper citation: RRID:Addgene_45532 Copy   


  • RRID:Addgene_45597

    This resource has 1+ mentions.

http://www.addgene.org/45597

Species: Mus musculus
Genetic Insert: c-Myc
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7143; Vector Backbone:pcDNA DEST40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15048125
Comments: Alternate plasmid names: pD40-His-c-Myc; pcDNA-DEST40 Myc wt This His6-tagged c-Myc plasmid was created by PCR amplification of the coding sequence for wild-type murine c-Myc2 from the CMVMyc plasmid (Hann et al., Genes Dev. 1994, PMID: 7958908) with a CACC 5′ extension added to the 5′ primer for cloning into the TOPO entry clone from Invitrogen (Carlsbad, CA). This sequence was then moved into the pDEST-40 mammalian expression vector using Gateway technology (Invitrogen), creating pD40-His-c-Myc. For plasmid usage information, see the associated article (Yeh et al. Nat Cell Biol. 2004) as well as Arnold et al. EMBO 2009 (PMID: 19131971).

Proper citation: RRID:Addgene_45597 Copy   


http://www.addgene.org/45630

Species: Mus musculus
Genetic Insert: Lpl in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Lpl fragment was amplified by RT-PCR using the following primer pair: TGCTGTGCAAAGAGAAGAGC CGGACACAAAGTTAGCACCA For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 3249-3900 of NM_008509.2, not bp# 3169-3826 as indicated on plasmid map. The plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_45630 Copy   


http://www.addgene.org/45633

Species: Mus musculus
Genetic Insert: Nectin-3 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Nectin-3 fragment was amplified by RT-PCR using the following primer pair: AAACAACCTGATCCGCAAAG CAGTGAAAACTGTAAAGCAGCTC For in vitro transcription, use the BamHI restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1626-2039 of NM_021495, not bp# 1624-2036 as indicated on plasmid map. The plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_45633 Copy   


http://www.addgene.org/45632

Species: Mus musculus
Genetic Insert: Ptn in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Ptn fragment was amplified by RT-PCR using the following primer pair: GCCTACCCGTCCAAATATCC GCCAGTTCTGGTCTTCAAGG For in vitro transcription, use the NotI restriction digest and SP6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1241-1830 of NM_008973, not bp# 1238-1827 as indicated on plasmid map. The plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_45632 Copy   


http://www.addgene.org/45628

Species: Mus musculus
Genetic Insert: Gpr88 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Gpr88 fragment was amplified by RT-PCR using the following primer pair: CAAATGAAACCAATGGTCAGG TATCTGTTTCCCGTGTCTCC For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 2742-3255 of AB042408.1 or bp# 2772-3285 of NM_022427, not bp# 2742-3255 of NM_022427 as indicated on plasmid map. The plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_45628 Copy   


http://www.addgene.org/45620

Species: Mus musculus
Genetic Insert: Foxp2 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16157277
Comments: The Fox2p fragment was amplified by RT-PCR using the following primer pair: CAGTGTGGACTGTGGACGAA TTCCAGGTCCTCAGATAAAGG For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp#1709-2142 of AF339106, not bp# 1707-2142 as indicated on plasmid map. The plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_45620 Copy   


http://www.addgene.org/45622

Species: Mus musculus
Genetic Insert: Tcrb-V13 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16157277
Comments: The Tcrb-V13 fragment was amplified by RT-PCR using the following primer pair: CTGAGCTGGTGGGTGAATG AAGGTGTCAACGAGGAAGGA For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 533-1058 of X67128, not bp# 532-1059 as indicated on plasmid map. The plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_45622 Copy   


http://www.addgene.org/45621

Species: Mus musculus
Genetic Insert: Plexin D1 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16157277
Comments: The Plexin D1 fragment was amplified by RT-PCR using the following primer pair: CAGGAAATGAACGCACACC TGAGGGACACAGACAACTGC; For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation.

Proper citation: RRID:Addgene_45621 Copy   


http://www.addgene.org/45623

Species: Mus musculus
Genetic Insert: Cux2 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16157277
Comments: The Cux2 fragment was amplified by RT-PCR using the following primer pair: TCAGTCAACAGCTCCATTCG GACAGCGAGAAAGTCCTTGG For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation.

Proper citation: RRID:Addgene_45623 Copy   


http://www.addgene.org/45600

Species: Mus musculus
Genetic Insert: Crim1 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15664173
Comments: Fragment was amplified using the following primers: TCTCAAGACTGTTGGTTGCTG TGAACAACCAATGATAGCACAG For in vitro transcription, use the NotI restriction digest and SP6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp#4062-4502 of NM_015800.3, not bp# 4708-5148 as indicated on plasmid map. The plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_45600 Copy   


http://www.addgene.org/45602

Species: Mus musculus
Genetic Insert: Diap3 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15664173
Comments: Fragment was amplified using the following primers: AGCAGTTCGCTGTTGTGATG GCACGTTTCTCCTTTTCTGC For in vitro transcription, use the SpeI restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1589-2321 of BC028920, not bp# 1610-2321 as indicated on plasmid map. The plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_45602 Copy   


  • RRID:Addgene_45913

    This resource has 1+ mentions.

http://www.addgene.org/45913

Species: Mus musculus
Genetic Insert: vesicle-associated membrane protein 7
Vector Backbone Description: Backbone Size:6400; Vector Backbone:CMV10 FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23217709

Proper citation: RRID:Addgene_45913 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X