Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: VSFP-CR
Vector Backbone Description: Backbone Marker:Invitrogen/Dr. Paulmurugan Ramasamy; Backbone Size:6107; Vector Backbone:pcDNA3.1/Puro-CAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22961245
Comments: Voltage sensor domain of Ci-VSP fused to a pair of fluorescent proteins consisting of a Clover GFP and mRuby2 RFP.
Proper citation: RRID:Addgene_40257 Copy
Species: Synthetic
Genetic Insert: AKAR2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5489; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22961245
Comments: ECFP was replaced with GFP Clover and Citrine was replaced with RFP mRuby2.
Note: there is a small sequence insertion downstream of the insert that adds restriction sites. This is not present in the full plasmids sequence, so please refer to Addgene's QC sequence with the BGH-Rev primer for additional information.
Proper citation: RRID:Addgene_40255 Copy
Species: Homo sapiens
Genetic Insert: drebrin E2
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5420; Vector Backbone:pETDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18806788
Proper citation: RRID:Addgene_40362 Copy
Species: Synechococcus elongatus PCC 7942
Genetic Insert: Km Resistance, neutral site II integration platform for Synechococcus
Vector Backbone Description: Vector Backbone:1572; Vector Types:Cyanobacteria cloning vector; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:10812624
Comments: NSII vector
cloning sites: NheI, XbaI, StuI, SalI, and EcoRV.
Km cassette into Klenow blunted BglII site of pAM1572. XhoI digest gives 0.7kb band. NSII vector; unique cloning sites NheI, XbaI, StuI, SalI, EcoRV.
Proper citation: RRID:Addgene_40240 Copy
Species: Rattus norvegicus
Genetic Insert: GCaMP6s
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3955; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23868258
Proper citation: RRID:Addgene_40753 Copy
Species: Homo sapiens
Genetic Insert: POU5F1_S234A_T235A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:10712; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22474382
Proper citation: RRID:Addgene_40630 Copy
Species: Arabidopsis thaliana
Genetic Insert: CRY2
Vector Backbone Description: Backbone Size:5414; Vector Backbone:p414TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22922268
Proper citation: RRID:Addgene_40593 Copy
Species: Homo sapiens
Genetic Insert: Cre recombinase
Vector Backbone Description: Backbone Marker:Michael Brenner (PMID: 7952266); Backbone Size:5500; Vector Backbone:pgfa2-lac2; Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11668683
Comments: This plasmid encodes a transgene to express the Cre recombinase in astrocytes of transgenic mice. A DNA fragment encoding the Cre recombinase was inserted into an expression cassette containing the gfa2 promoter (Besnard et al., 1991), a 2.2-kb 5' flanking region from the human GFAP (hGFAP) gene. The nuclear targeting signal from the SV40 large T antigen was inserted at the amino terminal end of the coding region, because it reportedly increases the efficiency of DNA excision by the recombinase (Gu et al., 1993). A heterologous intron and polyadenylation signal were provided by sequences from the mouse protamine 1 gene at the 3' end.
The hGFAP-cre transgene was constructed by excising the lacZ coding region from pgfa2-lac2 (Brenner et al., 1994) by BamHI digestion, and replacing it by blunt end ligation with a nuclear-targeted Cre coding sequence. The latter was obtained as a 1.1-kb SalI-MluI fragment from plasmid pTZ19RCreNLS, which was kindly provided by Drs. Raul Torres and Klaus Rajewsky. Both junctions were verified by DNA sequencing.
Proper citation: RRID:Addgene_40591 Copy
Species: Mus musculus
Genetic Insert: Syndecan-1 shRNA(UTR)
Vector Backbone Description: Backbone Size:10130; Vector Backbone:FUGW-H1; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22936997
Comments: This shRNA plasmid was generated by inserting the hairpin oligonucleotides into the FUGW-H1
lentiviral construct.
Proper citation: RRID:Addgene_40623 Copy
Species: Homo sapiens
Genetic Insert: Wnt reporter sequences
Vector Backbone Description: Backbone Marker:addgene; Vector Backbone:pSicoR PGK Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22177620
Comments: This lentiviral Wnt reporter has 7 repeats of Tcf/Lef binding sites, which was cloned by Xiaojun (Lance) Lian.
Methods for Plasmid construction, lentiviral production and infection of hESCs:
The 7 TCF/LEF binding site sequences were obtained by direct PCR of plasmid M50 (Addgene plasmid 12456) and the GreenFire (GF) sequences were obtained by direct PCR of the pGreenFire1-mCMV Plasmid (System Bioscience TR010PA-1). These two sequences were cloned into pSicoR PGK puro (Addgene plasmid 11586) digested by Xba I (NEB) and Xho I (NEB). The constructed Wnt reporter plasmid was named 7TGFP and verified by sequencing. This 7TGFP vector was cotransfected with the helper plasmids psPAX2 and pMD2.G (Addgene plasmids 12260 and 12259) into HEK-293TN cells (System Biosciences) for virus production. Virus-containing medium was collected at 48 and 72 hours after transfection and used for infection of hESCs in the presence of 6μg/mL polybrene (Sigma). Transduced cells were cultured in mTeSR1 on Matrigel for three days and then clonally isolated in mTeSR1 with 1 μg/mL puromycin.
Proper citation: RRID:Addgene_40588 Copy
Species: Homo sapiens
Genetic Insert: TCF7
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22949634
Proper citation: RRID:Addgene_40620 Copy
Species: Synthetic
Genetic Insert: Leucine Zipper prime - C super positive Green Fluorescent Protein
Vector Backbone Description: Backbone Size:4496; Vector Backbone:pMRBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22692102
Proper citation: RRID:Addgene_40730 Copy
Species: Mus musculus
Genetic Insert: AMPK-γ1
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pCMV-Tag4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17012231
Comments: AMPK-γ1 insert has Kozak sequence embedded at 5'-terminus and a stop codon at the 3'-terminus. The FLAG of the pCMV-Tag4a backbone is out of frame.
Proper citation: RRID:Addgene_40605 Copy
Species: Mus musculus
Genetic Insert: AMPK-β2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17012231
Proper citation: RRID:Addgene_40603 Copy
Species: Photinus pyralis
Genetic Insert: Firefly Luciferase
Vector Backbone Description: Backbone Marker:Miller et al (1998) Nucleic Acids Res 26(15):3577-3583 ; Backbone Size:6518; Vector Backbone:pBEVY-U; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24357599
Proper citation: RRID:Addgene_40601 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Renilla Luciferase
Vector Backbone Description: Backbone Marker:Miller et al (1998) Nucleic Acids Res 26(15):3577-3583 ; Backbone Size:6518; Vector Backbone:pBEVY-U; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24357599
Proper citation: RRID:Addgene_40600 Copy
Species: Homo sapiens
Genetic Insert: YWHAG
Vector Backbone Description: Backbone Marker:Emerald; Vector Backbone:pEMB52; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_40541 Copy
Species: Synthetic
Genetic Insert: CFP-24xPP7
Vector Backbone Description: Vector Backbone:pHAGE-CMV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22735544
Comments: Please note that the final PP7 stem loop ends with CCAGCAGAGCATATGGGCTCG The depositing laboratory confirmed that the plasmid functions as described in the associated publication.
The sequence for a single cassette (with the two non-identical stem-loops in uppercase) is:
taaggtacctaattgcctagaaaGGAGCAGACGATATGGCGTCGCTCCctgcaggtcgactctagaaa- CCAGCAGAGCATATGGGCTCGCTGGctgcagtattcccgggttcatt
Proper citation: RRID:Addgene_40652 Copy
Species: Synthetic
Genetic Insert: CFP-24xMBS
Vector Backbone Description: Vector Backbone:pHAGE-CMV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22735544
Comments: The Singer Lab no longer recommends this plasmid, as it has a higher rate of bacterial recombination.
For mammalian cells they recommend the following plasmids:
pUbC-FLAG-24xSuntagV4-oxEBFP-AID-baUTR1-24xMS2V5-Wpre (Plasmid #84561)
HaloTag-bActinCDS-bActinUTR-MS2V5 (Plasmid #102718)
For yeast cells they recommend the following plasmids:
pET246-pUC57 12xMS2V6 (Plasmid #104390)
pET259-pUC57 24xMS2V6 (Plasmid #104391)
pET251-pUC 12xMS2V6 Loxp KANr Loxp (Plasmid #104392)
pET264-pUC 24xMS2V6 Loxp KANr Loxp (Plasmid #104393)
Due to the propensity of the plasmid to recombine, Addgene recommends screening multiple colonies by restriction analysis to ensure that the isolated clones contain a full set of 24 MS2 repeats
Proper citation: RRID:Addgene_40651 Copy
Species: Synthetic
Genetic Insert: tdPCP-gfp
Vector Backbone Description: Vector Backbone:pHAGE-UBC-RIG (modified); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22735544
Comments: The linker region between the two PCPs is CGTGCGGATCCGCTAGCCTCC
Proper citation: RRID:Addgene_40650 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.