Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: GRP in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Comments: For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.
Proper citation: RRID:Addgene_45871 Copy
Species: Mus musculus
Genetic Insert: Inhba in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Inhba fragment was amplified by RT-PCR using the following primer pair:
GCGATCAGAAAGCTTCATGTG
AGACTGGCACCACTCTCCTG
For in vitro transcription, use the Spe1 restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
Proper citation: RRID:Addgene_45868 Copy
Species: Mus musculus
Genetic Insert: eIF2S2 aa89-331
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11959995
Comments: PCR amplified using EcoRI/BamHI containing primers.
G321D mutation is also present.
Proper citation: RRID:Addgene_45901 Copy
Species: Mus musculus
Genetic Insert: eIF2S2
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4900; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11959995
Proper citation: RRID:Addgene_45900 Copy
Species: Mus musculus
Genetic Insert: TMTC4 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Tmtc4 fragment was amplified by RT-PCR using the following primer pair:
GAAGCAGAGCAGAGCTACCG
TCTGAACAGAGGCTTCATGC
For in vitro transcription, use the Spe1 restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
Proper citation: RRID:Addgene_45869 Copy
Species: Mus musculus
Genetic Insert: Zfp536
Vector Backbone Description: Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23584610
Proper citation: RRID:Addgene_45845 Copy
Species: Mus musculus
Genetic Insert: VE-cadherin Tension Sensor
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23684974
Proper citation: RRID:Addgene_45848 Copy
Species: Mus musculus
Genetic Insert: VE-cadherin
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23684974
Proper citation: RRID:Addgene_45849 Copy
Species: Mus musculus
Genetic Insert: Olig2
Vector Backbone Description: Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23584610
Proper citation: RRID:Addgene_45844 Copy
Species: Mus musculus
Genetic Insert: Sox10
Vector Backbone Description: Backbone Size:8377; Vector Backbone:TetO-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23584610
Proper citation: RRID:Addgene_45843 Copy
Species: Mus musculus
Genetic Insert: Delta ATG1-mMCL1
Vector Backbone Description: Backbone Size:6295; Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22544066
Proper citation: RRID:Addgene_45823 Copy
Species: Mus musculus
Genetic Insert: mMCL-1 Delta C22
Vector Backbone Description: Backbone Size:6295; Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22544066
Proper citation: RRID:Addgene_45820 Copy
Species: Mus musculus
Genetic Insert: Runx1
Vector Backbone Description: Backbone Marker:Weinberg Lab (Addgene plasmid 1767); Backbone Size:5300; Vector Backbone:pBabe neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21873240
Comments: pBabe HA-Runx1 neo was constructed by PCR using a mouse Runx1 template (Open Biosystems) and the following primers: GCGCAGATCTATGTACCCATACGACGTCCCAGACTACGCTGCTTCAGACAGCATTTTTGAGTC (forward), GCGCGAATTCTCAGAAGCATTCACAGTTTCC (reverse).
The PCR product was gel purified, digested with BglII and EcoRI, and then ligated into pBabe neo, which had been digested with BamHI and EcoRI and then dephosphorylated.
Proper citation: RRID:Addgene_45815 Copy
Species: Mus musculus
Genetic Insert: Delta N67-mMCL-1
Vector Backbone Description: Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22544066
Comments: Note that AA68 has been changed from Pro to Met for start codon.
Proper citation: RRID:Addgene_45819 Copy
Species: Mus musculus
Genetic Insert: eIF2beta
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3500; Vector Backbone:pZeoSV2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:11959995
Comments: Two fragments were PCR amplified from GST-eIF2beta (Addgene plasmid 45900) and ligated together with vector to incorporate deletion. Xba1 site is used to ligate the 2 parts of eIF2beta.
Proper citation: RRID:Addgene_45899 Copy
Species: Mus musculus
Genetic Insert: vesicle-associated membrane protein 7
Vector Backbone Description: Backbone Marker:Dr.Shoji Yamaoka of Tokyo Medical and Dental University; Backbone Size:6600; Vector Backbone:pMRXIP GFP-Ci2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23217709
Proper citation: RRID:Addgene_45920 Copy
Species: Mus musculus
Genetic Insert: nonmuscle myosin heavy chain II-C, isoform C1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16790446
Proper citation: RRID:Addgene_46041 Copy
Species: Mus musculus
Genetic Insert: nonmuscle myosin heavy chain II-C, isoform C1C2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19240025
Proper citation: RRID:Addgene_46044 Copy
Species: Mus musculus
Genetic Insert: Hand2
Vector Backbone Description: Vector Backbone:tetO-Gateway; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23591016
Proper citation: RRID:Addgene_46028 Copy
Species: Mus musculus
Genetic Insert: Rab35
Vector Backbone Description: Backbone Size:8900; Vector Backbone:pUAST; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19729655
Proper citation: RRID:Addgene_46016 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.