Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: SEPTIN7
Vector Backbone Description: Vector Backbone:pnCS; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:34237139
Comments: SEPT9 isoform 3 is the protein product of transcript variant 3 (NCBI Reference Sequence: NP_006631.2).
Proper citation: RRID:Addgene_174501 Copy
Species: Homo sapiens
Genetic Insert: SEPTIN2
Vector Backbone Description: Vector Backbone:pnEA-vH; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34237139
Proper citation: RRID:Addgene_174497 Copy
Species: Homo sapiens
Genetic Insert: SEPTIN6
Vector Backbone Description: Vector Backbone:pnCS; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:34237139
Proper citation: RRID:Addgene_174499 Copy
Species: Homo sapiens
Genetic Insert: SEPTIN2
Vector Backbone Description: Vector Backbone:pnEA-vH; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34237139
Proper citation: RRID:Addgene_174491 Copy
Species: Homo sapiens
Genetic Insert: FECH with yeast HEM15 promoter and terminator
Vector Backbone Description: Backbone Size:5726; Vector Backbone:pRS426; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34517185
Comments: Please note: The plasmid contain 17 nucleotide discrepancies at N-terminus of the FEECH sequence compared to the depositor's provided sequence. The depositor noted that these differences do not affect the plasmid's function.
Proper citation: RRID:Addgene_174524 Copy
Species: Homo sapiens
Genetic Insert: VPS29
Vector Backbone Description: Backbone Size:4700; Vector Backbone:YFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18981234
Proper citation: RRID:Addgene_174520 Copy
Species: Homo sapiens
Genetic Insert: DDA1
Vector Backbone Description: Backbone Size:6785; Vector Backbone:pAC8; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31686031
Proper citation: RRID:Addgene_174480 Copy
Species: Homo sapiens
Genetic Insert: Bnip3L RNAi
Vector Backbone Description: Backbone Size:6349; Vector Backbone:pSuper-retro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15607964
Comments: Target sequence: AACAGTTCCTGGGTGGAGCTA
Proper citation: RRID:Addgene_17468 Copy
Species: Homo sapiens
Genetic Insert: human CD19, antigen minigene
Vector Backbone Description: Vector Backbone:MP71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34396986
Proper citation: RRID:Addgene_174610 Copy
Species: Homo sapiens
Genetic Insert: ubiquitination sgRNA
Vector Backbone Description: Backbone Marker:Feng Zhang (Addgene plasmid # 52961); Vector Backbone:lentiCRISPR v2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31692446
Proper citation: RRID:Addgene_174592 Copy
Species: Homo sapiens
Genetic Insert: FKBP-mCherry-RAB11
Vector Backbone Description: Vector Backbone:B-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32328628
Comments: Internal plasmid ID: WN175
Proper citation: RRID:Addgene_174622 Copy
Species: Homo sapiens
Genetic Insert: iLID-mCherry-RAB11
Vector Backbone Description: Vector Backbone:B-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32328628
Comments: Internal plasmid ID: WN105
Proper citation: RRID:Addgene_174623 Copy
Species: Homo sapiens
Genetic Insert: Xon cassette
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4242; Vector Backbone:pGL4.10[luc2]; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34321659
Proper citation: RRID:Addgene_174659 Copy
Species: Homo sapiens
Genetic Insert: EGFP-DFCP1
Vector Backbone Description: Vector Backbone:pLVX; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34447998
Comments: Internal plasmid ID: AJ212 bioRxiv 2021.04.21
Proper citation: RRID:Addgene_174651 Copy
Species: Homo sapiens
Genetic Insert: EGFP-Stx17
Vector Backbone Description: Vector Backbone:pLVX; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34447998
Comments: Internal plasmid ID: AJ213 bioRxiv 2021.04.21
Proper citation: RRID:Addgene_174652 Copy
Species: Homo sapiens
Genetic Insert: PARP1-K893I
Vector Backbone Description: Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-1014 (V762A, K893I) (see PMID: 8473297 for detail about the mutation)
Proper citation: RRID:Addgene_174799 Copy
Species: Homo sapiens
Genetic Insert: Meikin
Vector Backbone Description: Vector Backbone:pBABE-Blast; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34331869
Comments: pNM848 . Please visit https://doi.org/10.1101/2020.11.29.402537 for bioRxiv preprint
Proper citation: RRID:Addgene_174714 Copy
Species: Homo sapiens
Genetic Insert: Meikin
Vector Backbone Description: Vector Backbone:pBABE-Blast; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34331869
Comments: pNM849 . Please visit https://doi.org/10.1101/2020.11.29.402537 for bioRxiv preprint
Proper citation: RRID:Addgene_174715 Copy
Species: Homo sapiens
Genetic Insert: Rec8
Vector Backbone Description: Vector Backbone:pBABE-Blast; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34331869
Comments: pNM869, Rec8 is fused to human Meikin fragment containing Separase-resistant mutations (aa1-332, E151R, R154E) . Please visit https://doi.org/10.1101/2020.11.29.402537 for bioRxiv preprint
Proper citation: RRID:Addgene_174716 Copy
Species: Homo sapiens
Genetic Insert: Rec8
Vector Backbone Description: Vector Backbone:pBABE-Blast; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34331869
Comments: pNM937 . Please visit https://doi.org/10.1101/2020.11.29.402537 for bioRxiv preprint
Proper citation: RRID:Addgene_174717 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
