Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 169 showing 3361 ~ 3380 out of 33,857 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_41565

    This resource has 1+ mentions.

http://www.addgene.org/41565

Species: Homo sapiens
Genetic Insert: SIRT6
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/3PKI/

Proper citation: RRID:Addgene_41565 Copy   


  • RRID:Addgene_41661

http://www.addgene.org/41661

Species: Bos taurus
Genetic Insert: supervillin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10362542

Proper citation: RRID:Addgene_41661 Copy   


  • RRID:Addgene_41516

http://www.addgene.org/41516

Species: Synthetic
Genetic Insert: Polylinker flanked by 2 Mva1269I cut sites
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:2638; Vector Backbone:pEGFP-N1Δ4728-2101; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23242165

Proper citation: RRID:Addgene_41516 Copy   


  • RRID:Addgene_41689

http://www.addgene.org/41689

Species: Thermoplasma volcanium
Genetic Insert: Tvo VMA intein
Vector Backbone Description: Backbone Marker:novagen; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22001202

Proper citation: RRID:Addgene_41689 Copy   


  • RRID:Addgene_41823

http://www.addgene.org/41823

Species: Homo sapiens
Genetic Insert: gRNA_DNMT3b
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23287722
Comments: gRNA target sequence GAATTACTCACGCCCCAAGG

Proper citation: RRID:Addgene_41823 Copy   


  • RRID:Addgene_41818

    This resource has 50+ mentions.

http://www.addgene.org/41818

Genetic Insert: gRNA_AAVS1-T2
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23287722
Comments: gRNA target sequence GGGGCCACTAGGGACAGGAT

Proper citation: RRID:Addgene_41818 Copy   


  • RRID:Addgene_41817

    This resource has 10+ mentions.

http://www.addgene.org/41817

Genetic Insert: gRNA_AAVS1-T1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23287722
Comments: gRNA target sequence GTCCCCTCCACCCCACAGTG

Proper citation: RRID:Addgene_41817 Copy   


  • RRID:Addgene_41695

    This resource has 1+ mentions.

http://www.addgene.org/41695

Species: Pyrococcus horikoshii
Genetic Insert: PhoCDC21-1 intein
Vector Backbone Description: Backbone Marker:novagen; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22001202

Proper citation: RRID:Addgene_41695 Copy   


  • RRID:Addgene_41694

http://www.addgene.org/41694

Species: Methanococcus jannaschii
Genetic Insert: MjaTFIIB intein
Vector Backbone Description: Backbone Marker:novagen; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22001202

Proper citation: RRID:Addgene_41694 Copy   


  • RRID:Addgene_41948

    This resource has 1+ mentions.

http://www.addgene.org/41948

Species: Homo sapiens
Genetic Insert: ubiquitin specific peptidase 28
Vector Backbone Description: Backbone Size:4261; Vector Backbone:phCMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16901786

Proper citation: RRID:Addgene_41948 Copy   


http://www.addgene.org/42050

Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:5311; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23150874

Proper citation: RRID:Addgene_42050 Copy   


http://www.addgene.org/42051

Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:5311; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23150874

Proper citation: RRID:Addgene_42051 Copy   


http://www.addgene.org/42143

Species: Synthetic
Genetic Insert: pCMV-N1-superfolderGFP
Vector Backbone Description: Vector Backbone:pNICE; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22355283

Proper citation: RRID:Addgene_42143 Copy   


  • RRID:Addgene_42250

    This resource has 100+ mentions.

http://www.addgene.org/42250

Vector Backbone Description: Backbone Marker:Joung lab DR274; Backbone Size:2147; Vector Backbone:Zebrafish-gRNA-ExpressionVector; Vector Types:Worm Expression, CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964

Proper citation: RRID:Addgene_42250 Copy   


  • RRID:Addgene_42248

http://www.addgene.org/42248

Species: Danio rerio
Genetic Insert: gRNA-tia1l
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGTATGTCGGGAACCTCTCC Guide RNA sequence: TAATACGACTCACTATAGGTATGTCGGGAACCTCTCCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA

Proper citation: RRID:Addgene_42248 Copy   


  • RRID:Addgene_42242

http://www.addgene.org/42242

Species: Danio rerio
Genetic Insert: gRNA-drd3
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGAAACTACAGCCCAGCGTC Guide RNA sequence: TAATACGACTCACTATAGGAAACTACAGCCCAGCGTCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA

Proper citation: RRID:Addgene_42242 Copy   


  • RRID:Addgene_42243

http://www.addgene.org/42243

Species: Danio rerio
Genetic Insert: gRNA-fh site #1
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGAGCGGTACATGGCGACCG Guide RNA sequence: TAATACGACTCACTATAGGAGCGGTACATGGCGACCGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA

Proper citation: RRID:Addgene_42243 Copy   


  • RRID:Addgene_42246

http://www.addgene.org/42246

Species: Danio rerio
Genetic Insert: gRNA-rgs4
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGAGAAGGTGAAGGACACTG Guide RNA sequence: TAATACGACTCACTATAGGAGAAGGTGAAGGACACTGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA

Proper citation: RRID:Addgene_42246 Copy   


  • RRID:Addgene_42239

    This resource has 1+ mentions.

http://www.addgene.org/42239

Species: Homo sapiens
Genetic Insert: YAP1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2300; Vector Backbone:pEntr3c; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22308401

Proper citation: RRID:Addgene_42239 Copy   


  • RRID:Addgene_42197

    This resource has 1+ mentions.

http://www.addgene.org/42197

Species: Mus musculus
Genetic Insert: Frizzled 4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12958364
Comments: Fz4-GFP was generated by fusing EGFP (Clontech) at its C-terminus. Alternate plasmid names: pEGFPN2 mFz4; pEGFP-N2-Frizzled4

Proper citation: RRID:Addgene_42197 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X